ID: 1136289084

View in Genome Browser
Species Human (GRCh38)
Location 16:29260777-29260799
Sequence ACCGCCAGGCCAGCCCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136289084_1136289093 19 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289093 16:29260819-29260841 GGACTGTTTCAGGACCCCGATGG No data
1136289084_1136289095 21 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289095 16:29260821-29260843 ACTGTTTCAGGACCCCGATGGGG No data
1136289084_1136289088 -6 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289088 16:29260794-29260816 GGCGGTGCCGAGGTGCCTGGAGG No data
1136289084_1136289094 20 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289094 16:29260820-29260842 GACTGTTTCAGGACCCCGATGGG No data
1136289084_1136289089 -2 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289089 16:29260798-29260820 GTGCCGAGGTGCCTGGAGGCAGG No data
1136289084_1136289087 -9 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289087 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
1136289084_1136289092 9 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289092 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
1136289084_1136289096 30 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136289084 Original CRISPR ACCGCCAGGCCAGCCCATCA CGG (reversed) Intergenic