ID: 1136289086

View in Genome Browser
Species Human (GRCh38)
Location 16:29260791-29260813
Sequence CCAGGCACCTCGGCACCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136289086_1136289092 -5 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289092 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
1136289086_1136289093 5 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289093 16:29260819-29260841 GGACTGTTTCAGGACCCCGATGG No data
1136289086_1136289096 16 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data
1136289086_1136289100 22 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289100 16:29260836-29260858 CGATGGGGACGTAGAGGATGCGG No data
1136289086_1136289101 23 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289101 16:29260837-29260859 GATGGGGACGTAGAGGATGCGGG No data
1136289086_1136289095 7 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289095 16:29260821-29260843 ACTGTTTCAGGACCCCGATGGGG No data
1136289086_1136289094 6 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289094 16:29260820-29260842 GACTGTTTCAGGACCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136289086 Original CRISPR CCAGGCACCTCGGCACCGCC AGG (reversed) Intergenic