ID: 1136289090

View in Genome Browser
Species Human (GRCh38)
Location 16:29260801-29260823
Sequence AGTCCTGCCTCCAGGCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136289090_1136289096 6 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data
1136289090_1136289095 -3 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289095 16:29260821-29260843 ACTGTTTCAGGACCCCGATGGGG No data
1136289090_1136289093 -5 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289093 16:29260819-29260841 GGACTGTTTCAGGACCCCGATGG No data
1136289090_1136289101 13 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289101 16:29260837-29260859 GATGGGGACGTAGAGGATGCGGG No data
1136289090_1136289094 -4 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289094 16:29260820-29260842 GACTGTTTCAGGACCCCGATGGG No data
1136289090_1136289100 12 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289100 16:29260836-29260858 CGATGGGGACGTAGAGGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136289090 Original CRISPR AGTCCTGCCTCCAGGCACCT CGG (reversed) Intergenic