ID: 1136289091

View in Genome Browser
Species Human (GRCh38)
Location 16:29260809-29260831
Sequence CCTGAAACAGTCCTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136289091_1136289100 4 Left 1136289091 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
Right 1136289100 16:29260836-29260858 CGATGGGGACGTAGAGGATGCGG No data
1136289091_1136289101 5 Left 1136289091 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
Right 1136289101 16:29260837-29260859 GATGGGGACGTAGAGGATGCGGG No data
1136289091_1136289096 -2 Left 1136289091 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136289091 Original CRISPR CCTGAAACAGTCCTGCCTCC AGG (reversed) Intergenic