ID: 1136289096

View in Genome Browser
Species Human (GRCh38)
Location 16:29260830-29260852
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136289091_1136289096 -2 Left 1136289091 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data
1136289084_1136289096 30 Left 1136289084 16:29260777-29260799 CCGTGATGGGCTGGCCTGGCGGT No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data
1136289090_1136289096 6 Left 1136289090 16:29260801-29260823 CCGAGGTGCCTGGAGGCAGGACT No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data
1136289086_1136289096 16 Left 1136289086 16:29260791-29260813 CCTGGCGGTGCCGAGGTGCCTGG No data
Right 1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136289096 Original CRISPR GGACCCCGATGGGGACGTAG AGG Intergenic
No off target data available for this crispr