ID: 1136290490

View in Genome Browser
Species Human (GRCh38)
Location 16:29268557-29268579
Sequence CTCTCTGCGACTTCCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290490_1136290503 30 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290490_1136290497 11 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290497 16:29268591-29268613 GGTGGCCCAAGCCATCCTTCAGG No data
1136290490_1136290493 -10 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290493 16:29268570-29268592 TCGCAGAGAGCACCACCTGCAGG No data
1136290490_1136290494 -7 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290494 16:29268573-29268595 CAGAGAGCACCACCTGCAGGTGG No data
1136290490_1136290499 16 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290499 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290490 Original CRISPR CTCTCTGCGACTTCCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr