ID: 1136290491

View in Genome Browser
Species Human (GRCh38)
Location 16:29268561-29268583
Sequence GGTGCTCTCTGCGACTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290491_1136290503 26 Left 1136290491 16:29268561-29268583 CCCTGGAAGTCGCAGAGAGCACC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290491_1136290499 12 Left 1136290491 16:29268561-29268583 CCCTGGAAGTCGCAGAGAGCACC No data
Right 1136290499 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
1136290491_1136290497 7 Left 1136290491 16:29268561-29268583 CCCTGGAAGTCGCAGAGAGCACC No data
Right 1136290497 16:29268591-29268613 GGTGGCCCAAGCCATCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290491 Original CRISPR GGTGCTCTCTGCGACTTCCA GGG (reversed) Intergenic
No off target data available for this crispr