ID: 1136290496

View in Genome Browser
Species Human (GRCh38)
Location 16:29268585-29268607
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290496_1136290504 16 Left 1136290496 16:29268585-29268607 CCTGCAGGTGGCCCAAGCCATCC No data
Right 1136290504 16:29268624-29268646 AGAGCCCGGCACTCTGCAACCGG No data
1136290496_1136290507 25 Left 1136290496 16:29268585-29268607 CCTGCAGGTGGCCCAAGCCATCC No data
Right 1136290507 16:29268633-29268655 CACTCTGCAACCGGCTCTAGTGG No data
1136290496_1136290503 2 Left 1136290496 16:29268585-29268607 CCTGCAGGTGGCCCAAGCCATCC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290496 Original CRISPR GGATGGCTTGGGCCACCTGC AGG (reversed) Intergenic
No off target data available for this crispr