ID: 1136290498

View in Genome Browser
Species Human (GRCh38)
Location 16:29268596-29268618
Sequence CCTTTCCTGAAGGATGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290498_1136290511 26 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290511 16:29268645-29268667 GGCTCTAGTGGTCAAGGGTGAGG No data
1136290498_1136290509 21 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290509 16:29268640-29268662 CAACCGGCTCTAGTGGTCAAGGG No data
1136290498_1136290504 5 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290504 16:29268624-29268646 AGAGCCCGGCACTCTGCAACCGG No data
1136290498_1136290507 14 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290507 16:29268633-29268655 CACTCTGCAACCGGCTCTAGTGG No data
1136290498_1136290508 20 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290508 16:29268639-29268661 GCAACCGGCTCTAGTGGTCAAGG No data
1136290498_1136290503 -9 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290498 Original CRISPR CCTTTCCTGAAGGATGGCTT GGG (reversed) Intergenic
No off target data available for this crispr