ID: 1136290500

View in Genome Browser
Species Human (GRCh38)
Location 16:29268597-29268619
Sequence GCCTTTCCTGAAGGATGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290500_1136290509 20 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290509 16:29268640-29268662 CAACCGGCTCTAGTGGTCAAGGG No data
1136290500_1136290511 25 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290511 16:29268645-29268667 GGCTCTAGTGGTCAAGGGTGAGG No data
1136290500_1136290503 -10 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290500_1136290508 19 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290508 16:29268639-29268661 GCAACCGGCTCTAGTGGTCAAGG No data
1136290500_1136290504 4 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290504 16:29268624-29268646 AGAGCCCGGCACTCTGCAACCGG No data
1136290500_1136290507 13 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290507 16:29268633-29268655 CACTCTGCAACCGGCTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290500 Original CRISPR GCCTTTCCTGAAGGATGGCT TGG (reversed) Intergenic
No off target data available for this crispr