ID: 1136290503

View in Genome Browser
Species Human (GRCh38)
Location 16:29268610-29268632
Sequence CAGGAAAGGCACTCAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136290500_1136290503 -10 Left 1136290500 16:29268597-29268619 CCAAGCCATCCTTCAGGAAAGGC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290490_1136290503 30 Left 1136290490 16:29268557-29268579 CCAACCCTGGAAGTCGCAGAGAG No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290498_1136290503 -9 Left 1136290498 16:29268596-29268618 CCCAAGCCATCCTTCAGGAAAGG No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290492_1136290503 25 Left 1136290492 16:29268562-29268584 CCTGGAAGTCGCAGAGAGCACCA No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290496_1136290503 2 Left 1136290496 16:29268585-29268607 CCTGCAGGTGGCCCAAGCCATCC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290491_1136290503 26 Left 1136290491 16:29268561-29268583 CCCTGGAAGTCGCAGAGAGCACC No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data
1136290495_1136290503 5 Left 1136290495 16:29268582-29268604 CCACCTGCAGGTGGCCCAAGCCA No data
Right 1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136290503 Original CRISPR CAGGAAAGGCACTCAGAGCC CGG Intergenic
No off target data available for this crispr