ID: 1136294321

View in Genome Browser
Species Human (GRCh38)
Location 16:29293052-29293074
Sequence CAGTGTGAGCCGCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136294321_1136294327 -2 Left 1136294321 16:29293052-29293074 CCTTCTCCCTGCGGCTCACACTG No data
Right 1136294327 16:29293073-29293095 TGGCCGGTGGCACCCTCCATTGG No data
1136294321_1136294332 20 Left 1136294321 16:29293052-29293074 CCTTCTCCCTGCGGCTCACACTG No data
Right 1136294332 16:29293095-29293117 GCGCCCTCACTCTCTGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136294321 Original CRISPR CAGTGTGAGCCGCAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr