ID: 1136294903

View in Genome Browser
Species Human (GRCh38)
Location 16:29295981-29296003
Sequence TCGCGTCCTGCATTTCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136294896_1136294903 24 Left 1136294896 16:29295934-29295956 CCTTTAGAGCAGAGTGTTTTCTA No data
Right 1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG No data
1136294901_1136294903 -10 Left 1136294901 16:29295968-29295990 CCAGGATCTAGGTTCGCGTCCTG No data
Right 1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG No data
1136294895_1136294903 30 Left 1136294895 16:29295928-29295950 CCGGCTCCTTTAGAGCAGAGTGT No data
Right 1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG No data
1136294899_1136294903 -3 Left 1136294899 16:29295961-29295983 CCACCATCCAGGATCTAGGTTCG No data
Right 1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG No data
1136294900_1136294903 -6 Left 1136294900 16:29295964-29295986 CCATCCAGGATCTAGGTTCGCGT No data
Right 1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136294903 Original CRISPR TCGCGTCCTGCATTTCTAGG TGG Intergenic
No off target data available for this crispr