ID: 1136296781

View in Genome Browser
Species Human (GRCh38)
Location 16:29308505-29308527
Sequence GGTCTCCAGCGACACCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136296781_1136296789 22 Left 1136296781 16:29308505-29308527 CCAGCTTGGTGTCGCTGGAGACC No data
Right 1136296789 16:29308550-29308572 CATTAAATGAGCCTCAGTGCTGG No data
1136296781_1136296790 23 Left 1136296781 16:29308505-29308527 CCAGCTTGGTGTCGCTGGAGACC No data
Right 1136296790 16:29308551-29308573 ATTAAATGAGCCTCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136296781 Original CRISPR GGTCTCCAGCGACACCAAGC TGG (reversed) Intergenic
No off target data available for this crispr