ID: 1136297062

View in Genome Browser
Species Human (GRCh38)
Location 16:29309658-29309680
Sequence GTGCTCTTCTAGCGCCTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136297058_1136297062 10 Left 1136297058 16:29309625-29309647 CCAGGCAGCTGCCGCAGGGACTC No data
Right 1136297062 16:29309658-29309680 GTGCTCTTCTAGCGCCTCAGCGG No data
1136297055_1136297062 20 Left 1136297055 16:29309615-29309637 CCAGGAGCTACCAGGCAGCTGCC No data
Right 1136297062 16:29309658-29309680 GTGCTCTTCTAGCGCCTCAGCGG No data
1136297060_1136297062 -1 Left 1136297060 16:29309636-29309658 CCGCAGGGACTCAGGTACTCAGG No data
Right 1136297062 16:29309658-29309680 GTGCTCTTCTAGCGCCTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136297062 Original CRISPR GTGCTCTTCTAGCGCCTCAG CGG Intergenic
No off target data available for this crispr