ID: 1136298360

View in Genome Browser
Species Human (GRCh38)
Location 16:29316689-29316711
Sequence GCTCTGCTCACTTTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298360_1136298361 -8 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298361 16:29316704-29316726 AGCAGAGCCTCCTTCTCAGCAGG No data
1136298360_1136298364 14 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298364 16:29316726-29316748 GTCACCCAGATGCTGTGACCTGG No data
1136298360_1136298368 29 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data
1136298360_1136298365 17 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298360 Original CRISPR GCTCTGCTCACTTTTCTGCC TGG (reversed) Intergenic