ID: 1136298361

View in Genome Browser
Species Human (GRCh38)
Location 16:29316704-29316726
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298360_1136298361 -8 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298361 16:29316704-29316726 AGCAGAGCCTCCTTCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298361 Original CRISPR AGCAGAGCCTCCTTCTCAGC AGG Intergenic