ID: 1136298362

View in Genome Browser
Species Human (GRCh38)
Location 16:29316711-29316733
Sequence TGGGTGACCTGCTGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298362_1136298364 -8 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298364 16:29316726-29316748 GTCACCCAGATGCTGTGACCTGG No data
1136298362_1136298373 20 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298373 16:29316754-29316776 GTCCTGCAGGTGGCTGTGAGGGG No data
1136298362_1136298368 7 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data
1136298362_1136298365 -5 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data
1136298362_1136298372 19 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298372 16:29316753-29316775 AGTCCTGCAGGTGGCTGTGAGGG No data
1136298362_1136298371 18 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298371 16:29316752-29316774 TAGTCCTGCAGGTGGCTGTGAGG No data
1136298362_1136298370 10 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298370 16:29316744-29316766 CCTGGAGGTAGTCCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298362 Original CRISPR TGGGTGACCTGCTGAGAAGG AGG (reversed) Intergenic