ID: 1136298363

View in Genome Browser
Species Human (GRCh38)
Location 16:29316714-29316736
Sequence ATCTGGGTGACCTGCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298363_1136298371 15 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298371 16:29316752-29316774 TAGTCCTGCAGGTGGCTGTGAGG No data
1136298363_1136298365 -8 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data
1136298363_1136298370 7 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298370 16:29316744-29316766 CCTGGAGGTAGTCCTGCAGGTGG No data
1136298363_1136298372 16 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298372 16:29316753-29316775 AGTCCTGCAGGTGGCTGTGAGGG No data
1136298363_1136298373 17 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298373 16:29316754-29316776 GTCCTGCAGGTGGCTGTGAGGGG No data
1136298363_1136298368 4 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298363 Original CRISPR ATCTGGGTGACCTGCTGAGA AGG (reversed) Intergenic