ID: 1136298364 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:29316726-29316748 |
Sequence | GTCACCCAGATGCTGTGACC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1136298362_1136298364 | -8 | Left | 1136298362 | 16:29316711-29316733 | CCTCCTTCTCAGCAGGTCACCCA | No data | ||
Right | 1136298364 | 16:29316726-29316748 | GTCACCCAGATGCTGTGACCTGG | No data | ||||
1136298360_1136298364 | 14 | Left | 1136298360 | 16:29316689-29316711 | CCAGGCAGAAAAGTGAGCAGAGC | No data | ||
Right | 1136298364 | 16:29316726-29316748 | GTCACCCAGATGCTGTGACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1136298364 | Original CRISPR | GTCACCCAGATGCTGTGACC TGG | Intergenic | ||