ID: 1136298365

View in Genome Browser
Species Human (GRCh38)
Location 16:29316729-29316751
Sequence ACCCAGATGCTGTGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298360_1136298365 17 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data
1136298362_1136298365 -5 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data
1136298363_1136298365 -8 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298365 16:29316729-29316751 ACCCAGATGCTGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298365 Original CRISPR ACCCAGATGCTGTGACCTGG AGG Intergenic