ID: 1136298368

View in Genome Browser
Species Human (GRCh38)
Location 16:29316741-29316763
Sequence TGACCTGGAGGTAGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298363_1136298368 4 Left 1136298363 16:29316714-29316736 CCTTCTCAGCAGGTCACCCAGAT No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data
1136298360_1136298368 29 Left 1136298360 16:29316689-29316711 CCAGGCAGAAAAGTGAGCAGAGC No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data
1136298362_1136298368 7 Left 1136298362 16:29316711-29316733 CCTCCTTCTCAGCAGGTCACCCA No data
Right 1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298368 Original CRISPR TGACCTGGAGGTAGTCCTGC AGG Intergenic
No off target data available for this crispr