ID: 1136298805

View in Genome Browser
Species Human (GRCh38)
Location 16:29319632-29319654
Sequence AGAGCTCTCCGTAGCGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136298800_1136298805 22 Left 1136298800 16:29319587-29319609 CCTGTTGAATACAGGGCATCTCT No data
Right 1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG No data
1136298799_1136298805 23 Left 1136298799 16:29319586-29319608 CCCTGTTGAATACAGGGCATCTC No data
Right 1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136298805 Original CRISPR AGAGCTCTCCGTAGCGCAGG TGG Intergenic
No off target data available for this crispr