ID: 1136298805 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:29319632-29319654 |
Sequence | AGAGCTCTCCGTAGCGCAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1136298800_1136298805 | 22 | Left | 1136298800 | 16:29319587-29319609 | CCTGTTGAATACAGGGCATCTCT | No data | ||
Right | 1136298805 | 16:29319632-29319654 | AGAGCTCTCCGTAGCGCAGGTGG | No data | ||||
1136298799_1136298805 | 23 | Left | 1136298799 | 16:29319586-29319608 | CCCTGTTGAATACAGGGCATCTC | No data | ||
Right | 1136298805 | 16:29319632-29319654 | AGAGCTCTCCGTAGCGCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1136298805 | Original CRISPR | AGAGCTCTCCGTAGCGCAGG TGG | Intergenic | ||
No off target data available for this crispr |