ID: 1136299829

View in Genome Browser
Species Human (GRCh38)
Location 16:29326616-29326638
Sequence ACGATGACCTCTACTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136299829_1136299838 30 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299838 16:29326669-29326691 GGGCGGCTGCTGCAGAGCCTAGG No data
1136299829_1136299833 7 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299833 16:29326646-29326668 AGCTCTTAACATTTCACAGGTGG No data
1136299829_1136299832 4 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299832 16:29326643-29326665 ATGAGCTCTTAACATTTCACAGG No data
1136299829_1136299837 13 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299837 16:29326652-29326674 TAACATTTCACAGGTGGGGGCGG No data
1136299829_1136299836 10 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299836 16:29326649-29326671 TCTTAACATTTCACAGGTGGGGG No data
1136299829_1136299834 8 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299834 16:29326647-29326669 GCTCTTAACATTTCACAGGTGGG No data
1136299829_1136299835 9 Left 1136299829 16:29326616-29326638 CCATTTAAAGTAGAGGTCATCGT No data
Right 1136299835 16:29326648-29326670 CTCTTAACATTTCACAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136299829 Original CRISPR ACGATGACCTCTACTTTAAA TGG (reversed) Intergenic
No off target data available for this crispr