ID: 1136301364

View in Genome Browser
Species Human (GRCh38)
Location 16:29336495-29336517
Sequence CTCCAACAGCAGTGGCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136301364_1136301366 -3 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301366 16:29336515-29336537 GAGTTGAAATTAAAATGCAGTGG No data
1136301364_1136301368 7 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301368 16:29336525-29336547 TAAAATGCAGTGGCTGGTTCTGG No data
1136301364_1136301371 25 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301371 16:29336543-29336565 TCTGGTCATGGCTCCAGGCATGG No data
1136301364_1136301372 26 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301372 16:29336544-29336566 CTGGTCATGGCTCCAGGCATGGG No data
1136301364_1136301370 20 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301370 16:29336538-29336560 CTGGTTCTGGTCATGGCTCCAGG No data
1136301364_1136301367 1 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301367 16:29336519-29336541 TGAAATTAAAATGCAGTGGCTGG No data
1136301364_1136301369 13 Left 1136301364 16:29336495-29336517 CCAAATAGCCACTGCTGTTGGAG No data
Right 1136301369 16:29336531-29336553 GCAGTGGCTGGTTCTGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136301364 Original CRISPR CTCCAACAGCAGTGGCTATT TGG (reversed) Intergenic
No off target data available for this crispr