ID: 1136302188

View in Genome Browser
Species Human (GRCh38)
Location 16:29343156-29343178
Sequence TGGGTATGACTAAGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136302188_1136302194 26 Left 1136302188 16:29343156-29343178 CCTGTTATTCTTAGTCATACCCA No data
Right 1136302194 16:29343205-29343227 GTCTCATGAATGTCTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136302188 Original CRISPR TGGGTATGACTAAGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr