ID: 1136303280

View in Genome Browser
Species Human (GRCh38)
Location 16:29351164-29351186
Sequence CTGAACTAGAATTTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136303276_1136303280 -6 Left 1136303276 16:29351147-29351169 CCAAGGTCACACAGTGCCTGAAC No data
Right 1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG No data
1136303275_1136303280 -5 Left 1136303275 16:29351146-29351168 CCCAAGGTCACACAGTGCCTGAA No data
Right 1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136303280 Original CRISPR CTGAACTAGAATTTGGGACA AGG Intergenic
No off target data available for this crispr