ID: 1136311334

View in Genome Browser
Species Human (GRCh38)
Location 16:29413104-29413126
Sequence CTCCATCTTAAATAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136311329_1136311334 22 Left 1136311329 16:29413059-29413081 CCGCAGTGGGCAGTGATCATGTC No data
Right 1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136311334 Original CRISPR CTCCATCTTAAATAGGAGCC GGG Intergenic
No off target data available for this crispr