ID: 1136323754

View in Genome Browser
Species Human (GRCh38)
Location 16:29505540-29505562
Sequence CAGTTCCTGTCCCATGACCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 11, 1: 3, 2: 1, 3: 20, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136323754_1136323762 26 Left 1136323754 16:29505540-29505562 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1136323762 16:29505589-29505611 CCATTTGCAGAATGAGAACAGGG 0: 13
1: 1
2: 3
3: 35
4: 400
1136323754_1136323763 27 Left 1136323754 16:29505540-29505562 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1136323763 16:29505590-29505612 CATTTGCAGAATGAGAACAGGGG 0: 13
1: 0
2: 2
3: 37
4: 367
1136323754_1136323760 25 Left 1136323754 16:29505540-29505562 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1136323760 16:29505588-29505610 ACCATTTGCAGAATGAGAACAGG 0: 14
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136323754 Original CRISPR CAGTTCCTGTCCCATGACCA GGG (reversed) Exonic