ID: 1136323763

View in Genome Browser
Species Human (GRCh38)
Location 16:29505590-29505612
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 13, 1: 0, 2: 2, 3: 37, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136323754_1136323763 27 Left 1136323754 16:29505540-29505562 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1136323763 16:29505590-29505612 CATTTGCAGAATGAGAACAGGGG 0: 13
1: 0
2: 2
3: 37
4: 367
1136323755_1136323763 26 Left 1136323755 16:29505541-29505563 CCTGGTCATGGGACAGGAACTGT 0: 11
1: 4
2: 2
3: 30
4: 239
Right 1136323763 16:29505590-29505612 CATTTGCAGAATGAGAACAGGGG 0: 13
1: 0
2: 2
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type