ID: 1136324782

View in Genome Browser
Species Human (GRCh38)
Location 16:29514897-29514919
Sequence CTCCATCTTAAATAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136324778_1136324782 22 Left 1136324778 16:29514852-29514874 CCGCAGTGGGCAATGATCATGTC No data
Right 1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136324782 Original CRISPR CTCCATCTTAAATAGGAGCC AGG Intergenic
No off target data available for this crispr