ID: 1136335386

View in Genome Browser
Species Human (GRCh38)
Location 16:29607124-29607146
Sequence TCTCGCGGGACTCTGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136335386_1136335399 16 Left 1136335386 16:29607124-29607146 CCCGCAGCCAGAGTCCCGCGAGA No data
Right 1136335399 16:29607163-29607185 CCCTGCGTGACGGCACGCCTGGG No data
1136335386_1136335401 30 Left 1136335386 16:29607124-29607146 CCCGCAGCCAGAGTCCCGCGAGA No data
Right 1136335401 16:29607177-29607199 ACGCCTGGGACTGTCCCAGCAGG No data
1136335386_1136335394 6 Left 1136335386 16:29607124-29607146 CCCGCAGCCAGAGTCCCGCGAGA No data
Right 1136335394 16:29607153-29607175 GACGGCCTGCCCCTGCGTGACGG No data
1136335386_1136335397 15 Left 1136335386 16:29607124-29607146 CCCGCAGCCAGAGTCCCGCGAGA No data
Right 1136335397 16:29607162-29607184 CCCCTGCGTGACGGCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136335386 Original CRISPR TCTCGCGGGACTCTGGCTGC GGG (reversed) Intergenic