ID: 1136339383

View in Genome Browser
Species Human (GRCh38)
Location 16:29631864-29631886
Sequence GGGCTGGTCCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136339383_1136339387 -4 Left 1136339383 16:29631864-29631886 CCCAGCTCCATCTGGACCAGCCC No data
Right 1136339387 16:29631883-29631905 GCCCGCACCATTGTTAACACAGG No data
1136339383_1136339392 26 Left 1136339383 16:29631864-29631886 CCCAGCTCCATCTGGACCAGCCC No data
Right 1136339392 16:29631913-29631935 CTCATCCGTCCGCACATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136339383 Original CRISPR GGGCTGGTCCAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr