ID: 1136342957

View in Genome Browser
Species Human (GRCh38)
Location 16:29656871-29656893
Sequence CCGGGTGGCAAGGGCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136342945_1136342957 13 Left 1136342945 16:29656835-29656857 CCCTGGGCTTGCTTTCTCCAGGG No data
Right 1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG No data
1136342947_1136342957 12 Left 1136342947 16:29656836-29656858 CCTGGGCTTGCTTTCTCCAGGGA No data
Right 1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG No data
1136342949_1136342957 -4 Left 1136342949 16:29656852-29656874 CCAGGGACACATCAGAGGTCCGG No data
Right 1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136342957 Original CRISPR CCGGGTGGCAAGGGCGTGGA TGG Intergenic
No off target data available for this crispr