ID: 1136344268

View in Genome Browser
Species Human (GRCh38)
Location 16:29664851-29664873
Sequence CCATCCTCACTGGCCACCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 1, 2: 3, 3: 73, 4: 290}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136344268_1136344283 23 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344283 16:29664897-29664919 ATGAGCCCGAAGGGGGAGACGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1136344268_1136344279 15 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344279 16:29664889-29664911 AGCTCCTGATGAGCCCGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 277
1136344268_1136344282 22 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344282 16:29664896-29664918 GATGAGCCCGAAGGGGGAGACGG 0: 1
1: 0
2: 0
3: 22
4: 202
1136344268_1136344277 13 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344277 16:29664887-29664909 CCAGCTCCTGATGAGCCCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 192
1136344268_1136344280 16 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344280 16:29664890-29664912 GCTCCTGATGAGCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
1136344268_1136344278 14 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344278 16:29664888-29664910 CAGCTCCTGATGAGCCCGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 99
1136344268_1136344284 24 Left 1136344268 16:29664851-29664873 CCACTGGTGGCCAGTGAGGATGG 0: 1
1: 1
2: 3
3: 73
4: 290
Right 1136344284 16:29664898-29664920 TGAGCCCGAAGGGGGAGACGGGG 0: 1
1: 0
2: 1
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136344268 Original CRISPR CCATCCTCACTGGCCACCAG TGG (reversed) Exonic