ID: 1136355692

View in Genome Browser
Species Human (GRCh38)
Location 16:29744001-29744023
Sequence TCATCTGGATGCGATCTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136355689_1136355692 3 Left 1136355689 16:29743975-29743997 CCTGACTATCTAGTACCTTGGGT 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1136355692 16:29744001-29744023 TCATCTGGATGCGATCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 60
1136355686_1136355692 9 Left 1136355686 16:29743969-29743991 CCATTTCCTGACTATCTAGTACC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1136355692 16:29744001-29744023 TCATCTGGATGCGATCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136355692 Original CRISPR TCATCTGGATGCGATCTTGA AGG Exonic