ID: 1136358753

View in Genome Browser
Species Human (GRCh38)
Location 16:29763964-29763986
Sequence ATGAGTGGCATGCGTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136358753_1136358760 22 Left 1136358753 16:29763964-29763986 CCTGCCACACGCATGCCACTCAT No data
Right 1136358760 16:29764009-29764031 CTCCTATGTGACCAGAATTCTGG No data
1136358753_1136358761 23 Left 1136358753 16:29763964-29763986 CCTGCCACACGCATGCCACTCAT No data
Right 1136358761 16:29764010-29764032 TCCTATGTGACCAGAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136358753 Original CRISPR ATGAGTGGCATGCGTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr