ID: 1136360767

View in Genome Browser
Species Human (GRCh38)
Location 16:29778221-29778243
Sequence CACAATAAAGGGCAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 6, 3: 78, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136360758_1136360767 17 Left 1136360758 16:29778181-29778203 CCGAAGAGGTTGCTCATGTTTGC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG 0: 1
1: 1
2: 6
3: 78
4: 406
1136360757_1136360767 23 Left 1136360757 16:29778175-29778197 CCTGATCCGAAGAGGTTGCTCAT 0: 1
1: 0
2: 0
3: 11
4: 272
Right 1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG 0: 1
1: 1
2: 6
3: 78
4: 406
1136360756_1136360767 30 Left 1136360756 16:29778168-29778190 CCTGACACCTGATCCGAAGAGGT 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG 0: 1
1: 1
2: 6
3: 78
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136360767 Original CRISPR CACAATAAAGGGCAGGAGGA GGG Exonic
900001944 1:19333-19355 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
900021664 1:189856-189878 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
902338451 1:15767386-15767408 CACCATCCAGGACAGGAGGAGGG - Exonic
902359776 1:15936014-15936036 CACCATGAGGGGCAGGAGCAGGG - Exonic
902627771 1:17686692-17686714 CACAAGGAAGGGCAGGAGTGGGG + Intronic
903911720 1:26731615-26731637 CACAGGGAAGGGCAGGAGGCAGG - Intronic
904458129 1:30659265-30659287 CCCAGTAAGAGGCAGGAGGAGGG + Intergenic
904565311 1:31425134-31425156 AACCCTAAGGGGCAGGAGGAAGG - Intronic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
906915330 1:50003672-50003694 AACAATAAAGGTCAGAAGGAAGG + Intronic
907392540 1:54167684-54167706 GACAATGAAGGGCATGTGGATGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
908288798 1:62640597-62640619 CAAAATACAGGGAAGGAGCAAGG + Intronic
908515972 1:64893151-64893173 AAAAATAAAGGCCAGGAAGAAGG + Intronic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910383810 1:86659731-86659753 CAAAAGAAAGGGATGGAGGAAGG + Intergenic
910436651 1:87212188-87212210 CACAAGAAAGGAAAGGAGGAAGG + Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910801074 1:91146922-91146944 GAAAATAAAGGGCTGGAGAAAGG - Intergenic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912531461 1:110326728-110326750 CACAACAAAGAACAGGAGAATGG + Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913477062 1:119248084-119248106 CACTGAAAAGTGCAGGAGGAGGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
914233668 1:145788738-145788760 CACAAGAGAGGGCAGAAGAATGG - Intronic
914255250 1:145957438-145957460 CTCAGTAAAGGGGAGGAGGTAGG + Intronic
914741559 1:150470293-150470315 CACAATAAAAGGCAACAGGAAGG - Intronic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
915076653 1:153313170-153313192 CACCAGCAGGGGCAGGAGGAAGG + Intergenic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
915985224 1:160457865-160457887 AACAGGAAAGGGAAGGAGGAAGG + Intergenic
916463262 1:165048138-165048160 GAAAATAAGGGGCAGGAGGGAGG - Intergenic
916785562 1:168084808-168084830 CACTATAAAAGACAAGAGGAAGG - Exonic
917868265 1:179218593-179218615 CACCATGTAGGCCAGGAGGATGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
921093899 1:211870338-211870360 AACAATAAAGATCAGAAGGAAGG + Intergenic
921918557 1:220641599-220641621 CAAAATAAAGGGAAGAAGGAAGG + Intronic
922086162 1:222349072-222349094 CACAATCAAAGGCAGGAAGCAGG + Intergenic
922436527 1:225612840-225612862 CAAAAAAAAGGGGGGGAGGAGGG + Intronic
922986194 1:229867704-229867726 CACTAGAAACTGCAGGAGGAAGG - Intergenic
923050613 1:230388919-230388941 GACAAGAAAGGGCAGGAGCCAGG + Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923388021 1:233484951-233484973 CATAAAATAGGGCAGGGGGATGG - Intergenic
924837838 1:247672342-247672364 CACAGTAGAAGGCAAGAGGAAGG - Exonic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063988367 10:11532956-11532978 AACAATGAAGGGAAGAAGGAAGG - Intronic
1064246872 10:13675238-13675260 CACAAGAAATGGCAGGAAGATGG + Intronic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1066417249 10:35232753-35232775 CACATGAACGGGAAGGAGGAAGG + Intergenic
1067176410 10:43952256-43952278 AATAATAAATGACAGGAGGAAGG - Intergenic
1067327095 10:45279848-45279870 GAAAATAATGAGCAGGAGGAAGG + Intergenic
1068732790 10:60377713-60377735 CAGAATAAAGGCCAGGGGCAGGG + Intronic
1069098098 10:64284679-64284701 AAAAAAAAAGGGCAGGAGAAAGG + Intergenic
1070581018 10:77719630-77719652 GACAATACAGGGGAGGAGGGAGG - Intergenic
1072139386 10:92576008-92576030 CTCAATAAAGAGGAGGTGGATGG + Intergenic
1072635770 10:97176891-97176913 CACATTAGAGGGCAGGAGGAAGG - Intronic
1073390917 10:103175846-103175868 CACAAAAATTGGAAGGAGGACGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073909667 10:108326821-108326843 CACAATGAAGGAGAGAAGGAGGG - Intergenic
1074293252 10:112157570-112157592 CAAAAGAAAGGGCAGGTGGGAGG + Intronic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1075785016 10:125043236-125043258 CAGAATCAAGGGCAGGGGAAAGG + Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076271295 10:129154524-129154546 CTCAATAAGGGACAGGAGGCAGG - Intergenic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1080033850 11:27690287-27690309 CACAGAAATGGGCAGCAGGATGG + Intronic
1080125771 11:28731858-28731880 AACAATAAAAGGAAGGAGAATGG + Intergenic
1080394435 11:31876743-31876765 AAGAAGAAAGGACAGGAGGAAGG + Intronic
1080751322 11:35152854-35152876 CTCAATAAAGGGCTAGAGGTGGG + Intronic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1081458295 11:43247041-43247063 GAAAATAAAGGGTAGGAGCAGGG - Intergenic
1081716385 11:45253454-45253476 CATAATAAAGTATAGGAGGAAGG + Intronic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083877402 11:65531556-65531578 CACCTGAAAGGGCAGGAAGATGG - Exonic
1084325281 11:68396650-68396672 CACAGTCAAGGCCAGCAGGAGGG - Intronic
1084767190 11:71320294-71320316 CAACACAAAGGGCAGAAGGATGG + Intergenic
1086025815 11:82290144-82290166 AACAAAAAAGGGCAGGAATAGGG - Intergenic
1087858506 11:103123814-103123836 AAAAAAAAAGGGCAGGAGGAGGG - Intronic
1087975719 11:104544055-104544077 GACAGTGAAGGGTAGGAGGAGGG + Intergenic
1088280086 11:108126721-108126743 TGCAATAAAGGGAAGGATGAAGG + Intronic
1090254878 11:125276568-125276590 CACAATAAAGGGCTTGTTGATGG + Intronic
1090440445 11:126720907-126720929 TACATTAAAGGGCAGGGGCAGGG + Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1091488186 12:909748-909770 ATCAATAAAGGGCATGTGGAAGG + Exonic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094743690 12:33318034-33318056 CACAATATAGGTAAGGAAGAAGG - Intergenic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095298198 12:40551078-40551100 CACTATAAAGGGGAGGAAGAAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095535311 12:43239212-43239234 CATGAGAAAGGGCAGGGGGAAGG - Intergenic
1096262998 12:50104535-50104557 CACAGGAAAGTACAGGAGGAGGG - Intronic
1097376383 12:58848227-58848249 CAAAAAAAAGGGAGGGAGGAAGG - Intergenic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1097691011 12:62734739-62734761 TTCAATAAAGAGCAGGAGGTGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099340795 12:81431305-81431327 CACAATAAAGGGAAGTACAAGGG - Intronic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1099955276 12:89347243-89347265 CAAAATAAAAGGCAGGTGTATGG - Exonic
1100128507 12:91460405-91460427 TACAATAAAGTGAAGAAGGAGGG - Intergenic
1101363701 12:104051726-104051748 CACTGGGAAGGGCAGGAGGAAGG - Intronic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1103558012 12:121777558-121777580 CAGAATGAAGGGCAGGGGGGTGG - Exonic
1104014515 12:124953039-124953061 CACAGCGAATGGCAGGAGGATGG + Intronic
1104252475 12:127108719-127108741 CATAAAAAATGTCAGGAGGAGGG + Intergenic
1105352337 13:19627033-19627055 CACACTGATGGGGAGGAGGAAGG + Intergenic
1105924236 13:24992511-24992533 CACAAAAAAGAGCGGGAGCAAGG - Intergenic
1106279821 13:28256613-28256635 CACAATAAAAAGCTGCAGGAGGG - Intronic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1107489575 13:40868432-40868454 CAAAATAAATGGATGGAGGAAGG - Intergenic
1108067000 13:46588460-46588482 TACAATAAAAAGCTGGAGGAAGG - Intronic
1109826938 13:67734076-67734098 CTAAATAAAAGGCAAGAGGAAGG - Intergenic
1110352696 13:74528189-74528211 CACAAAGAATGGAAGGAGGAAGG - Intergenic
1110982667 13:81920711-81920733 CACAACAAAGGGGTGAAGGAGGG + Intergenic
1112990465 13:105507042-105507064 AATAACACAGGGCAGGAGGAGGG + Intergenic
1113337505 13:109391286-109391308 AACAGTAAAGTGCAGGTGGAGGG - Intergenic
1114646602 14:24259619-24259641 ATCCAGAAAGGGCAGGAGGAGGG + Intronic
1115953086 14:38743917-38743939 AACAATACATGGCAGGAGGATGG + Intergenic
1116215529 14:42012243-42012265 CAAAACAAAGGGTAGGAGTAAGG - Intergenic
1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG + Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1118986643 14:70761259-70761281 CACAGGAGAGGCCAGGAGGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1120010625 14:79409769-79409791 AACAACAAAGGGCTGGAGAATGG - Intronic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1120106218 14:80498407-80498429 GACCATTAAGGGCAGGATGAGGG - Intronic
1120387242 14:83862101-83862123 CAGATTAGAAGGCAGGAGGAGGG - Intergenic
1121267596 14:92614341-92614363 CCCAGTAGAGGCCAGGAGGAAGG - Intronic
1121312214 14:92941327-92941349 CACAGTAGAGAGCAGGCGGACGG + Exonic
1121688403 14:95856775-95856797 CTCATTAGAGGGCAGCAGGAGGG - Intergenic
1123483870 15:20665880-20665902 GACAGTAGAGGTCAGGAGGATGG + Intergenic
1125437962 15:39668288-39668310 CACAAAAAAGGCGAGGAAGAAGG - Intronic
1125679073 15:41519623-41519645 CATGACAAAGGGCAGAAGGAGGG - Intronic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127275000 15:57434977-57434999 CCTAATATAGGGTAGGAGGAGGG + Intronic
1128716422 15:69911769-69911791 TGCAAAAAAGGGCAGGAGGGGGG - Intergenic
1129268454 15:74407342-74407364 CACAAGAGAGGGGAGAAGGATGG + Intergenic
1130896416 15:88173674-88173696 CAAAATGAAGGGCAGATGGAGGG - Intronic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132451566 15:101971606-101971628 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
1132455324 16:19022-19044 CATGAGGAAGGGCAGGAGGAGGG + Exonic
1132603001 16:782223-782245 AACAGTAAAAGGCAGGAGCAGGG + Intronic
1132792268 16:1698196-1698218 CACAAGAGAGGGATGGAGGATGG + Intronic
1133116587 16:3581062-3581084 CAAAGTAAAGGGCAGGTGCAAGG + Intergenic
1133208614 16:4249623-4249645 TTCAAGAAAGGACAGGAGGATGG + Intergenic
1133656661 16:7871557-7871579 CACTTTAACAGGCAGGAGGACGG + Intergenic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1134001966 16:10789888-10789910 CTCAAAGAGGGGCAGGAGGAGGG + Intronic
1134683586 16:16143517-16143539 AAAAAAAAAGGGCAGGGGGAGGG - Intergenic
1135269485 16:21056634-21056656 AACAATAAATGGTTGGAGGAAGG + Intronic
1135823128 16:25702534-25702556 GACAGGAAAGGGGAGGAGGAAGG - Intronic
1136068821 16:27776127-27776149 AACAATAAAGGTCAGGGTGAGGG - Intronic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1137006565 16:35280601-35280623 CACAAAAAAAGGCAGTAAGAAGG - Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138637409 16:58352150-58352172 CCCAAACAAGGGCAGGGGGAGGG - Intronic
1138801259 16:60033061-60033083 CACTGTAAAGGAGAGGAGGAGGG - Intergenic
1139840092 16:69871700-69871722 TCCAATAAATGGCAGGAGAAGGG + Intronic
1140780812 16:78294759-78294781 GACAAGAAAGGAAAGGAGGAAGG + Intronic
1140869712 16:79095413-79095435 CAAAATAAATGGCAGGTGGAAGG + Intronic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1143726179 17:8848162-8848184 CACCAGAAAGGGCAGGGGAAGGG - Intronic
1144741065 17:17582531-17582553 CACAACAAAGGGCAGGGGAATGG + Intronic
1146057194 17:29587418-29587440 CACAATAGAGGTCAGGAAGGTGG - Intronic
1146478209 17:33180320-33180342 CACAATGAGGGGAAGGAGCATGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147283291 17:39380606-39380628 CAAAATAAAGGGCAGGAAAGGGG - Intronic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147710452 17:42459549-42459571 ATCATTAAAGAGCAGGAGGACGG + Intronic
1147977342 17:44255351-44255373 GTGAATATAGGGCAGGAGGAAGG - Intronic
1149295409 17:55257603-55257625 CACAATAAAGGGAGGGAAGTTGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151635079 17:75341583-75341605 GAAAAAAAAGGGAAGGAGGAAGG + Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1151883092 17:76906359-76906381 CCCAAGACCGGGCAGGAGGAGGG - Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1156136488 18:34046077-34046099 TACAGAAAAGGGCAAGAGGAAGG - Intronic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1158783172 18:60676779-60676801 GACAAGAAAGGGCAGGTGGCGGG + Intergenic
1159174843 18:64819103-64819125 TACAATAAAGATCAGTAGGAAGG + Intergenic
1159863259 18:73674157-73674179 CACAATGAAGGGCAAAAAGAAGG - Intergenic
1160633696 19:60941-60963 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1163194150 19:15702766-15702788 CACAATAACAGCCAGCAGGAAGG + Intergenic
1163914339 19:20227051-20227073 GAAAATAAAGGGACGGAGGAAGG - Intergenic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1164677214 19:30109576-30109598 CACACTAGAGGGCAGGAGCTTGG - Intergenic
1164882308 19:31742656-31742678 CAGAATGAAGGACAGGAGGGAGG + Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165799332 19:38537951-38537973 CACAATAATGGTGAGGAGGAGGG + Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1168298875 19:55391943-55391965 CACAAACACGGGCAGGAGGCTGG - Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
926000785 2:9330766-9330788 CAAAATAAAGGGGCGGGGGAAGG - Intronic
926244654 2:11113752-11113774 AAGAAGAAAGGGGAGGAGGAAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
927740887 2:25568821-25568843 CAGAATGAAGGGGAGGAGAACGG - Intronic
929618021 2:43327587-43327609 TTAAATAAAGGGCAGGAGGCGGG - Intronic
931287796 2:60847271-60847293 AACAAAAAAAGGGAGGAGGAGGG - Intergenic
931529930 2:63202033-63202055 CAAAAAAAAAGGCAGAAGGAAGG - Intronic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932796553 2:74700799-74700821 CAGAACAAAGGACAGAAGGAAGG + Intergenic
933188753 2:79308990-79309012 GACAATATAGGGCAGCAGGAAGG - Intronic
933310682 2:80658051-80658073 GAGAATAGAGGGTAGGAGGAGGG + Intergenic
933761488 2:85675299-85675321 CTCAATCAAAGGCAGAAGGAAGG + Intergenic
934885748 2:98022709-98022731 CACAATTGAGGGGAGGATGAGGG - Intergenic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935652314 2:105392741-105392763 GACAAAAAAAGGAAGGAGGAGGG + Intronic
935696797 2:105777270-105777292 AACATTAAAAGGCAGGAGGAAGG - Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936567778 2:113594072-113594094 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
936679809 2:114757200-114757222 GAGAAAAATGGGCAGGAGGAAGG + Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
937147345 2:119659076-119659098 TACAATTAAGGAAAGGAGGAAGG - Intronic
937394322 2:121521218-121521240 CAAAATAATGGGGTGGAGGAGGG + Intronic
938225750 2:129614711-129614733 CACAAGAACAGGAAGGAGGAGGG + Intergenic
939915643 2:148040028-148040050 AAAAATTAAGGGCGGGAGGAGGG + Intronic
940001710 2:148973208-148973230 CACAATAAAGGGCTGTAGTGTGG - Intronic
940705570 2:157101131-157101153 CAAAATAAAGGGATTGAGGAAGG - Intergenic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
944875180 2:203957049-203957071 AAGACTAAAGGTCAGGAGGAAGG + Intronic
945176271 2:207046808-207046830 GGCACCAAAGGGCAGGAGGAGGG + Intergenic
945477683 2:210304783-210304805 CTCAACAATGGGCAGGATGATGG - Intronic
945965081 2:216178408-216178430 CACAATACAGGGCATCAGTAGGG - Intronic
946613424 2:221483310-221483332 CGAGTTAAAGGGCAGGAGGAGGG - Intronic
947202509 2:227627281-227627303 CACAAACCAGGGCAGGGGGATGG - Intronic
948282909 2:236762136-236762158 CAAAATCTAGGGCAGGTGGAGGG + Intergenic
948448571 2:238053784-238053806 GACAGGAATGGGCAGGAGGAGGG + Intronic
948610036 2:239161073-239161095 CACAAAAAAAGGCATGGGGATGG - Intronic
948694789 2:239727729-239727751 AACAAGAAAGGGCAGGTGCAAGG - Intergenic
1168811874 20:709945-709967 CACAATCAAAGGCGGGCGGAGGG - Intergenic
1170706440 20:18748653-18748675 TAAAAAGAAGGGCAGGAGGAGGG + Intronic
1170846543 20:19966674-19966696 CACAATAAATGGCCTCAGGAAGG + Intronic
1171301525 20:24065136-24065158 AACAAGAGAGGGAAGGAGGAAGG - Intergenic
1171362215 20:24595531-24595553 TACAAAAAAGTGGAGGAGGAGGG - Intronic
1171769914 20:29314411-29314433 CACTCCAAAGGGGAGGAGGAGGG + Intergenic
1171904160 20:30886743-30886765 CAAAATAAAGTGATGGAGGAAGG - Intergenic
1172979736 20:38931885-38931907 AGAAATAAAGGGCAGGGGGAAGG + Intronic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173089005 20:39952445-39952467 CACAAGAAAAGGAAGGAGGGAGG + Intergenic
1173561534 20:44009334-44009356 GACAAGAAAGGGAAGGAGGGTGG + Intronic
1173759605 20:45547894-45547916 TACAATAAAAGACAGAAGGATGG - Intergenic
1173927237 20:46789858-46789880 CACACTCCAGGGAAGGAGGATGG - Intergenic
1175161467 20:57011126-57011148 CACAATAAAGAGTAGAAGCAAGG - Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1177670175 21:24214575-24214597 CAAAAGAAAGGGAGGGAGGAAGG + Intergenic
1178889721 21:36510846-36510868 GCCAGTAAAGGGCAGGAGGTTGG + Intronic
1179982171 21:44901312-44901334 TGCAGGAAAGGGCAGGAGGAAGG - Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1182347781 22:29678865-29678887 CACAATAAAGGGAAGACGGAGGG - Intronic
1183831812 22:40422192-40422214 CCCAATTAAAGGGAGGAGGAAGG + Intronic
1183918974 22:41148340-41148362 AACTCTAAAGGGCAGCAGGAGGG - Intronic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1184757175 22:46523621-46523643 AAGAATACAGGGCAGGAGAAAGG + Intronic
1185162370 22:49237746-49237768 CTCCATAGAGGGCAGGAGGCTGG - Intergenic
949508053 3:4745011-4745033 GAAAAGAAAGGGAAGGAGGAAGG - Intronic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950297145 3:11842045-11842067 CGCTTTAAAGGGCAGGAGGTTGG - Intronic
951052880 3:18114233-18114255 TACAATAAAGAGCCGGTGGAAGG - Intronic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
952359359 3:32614294-32614316 CACAGTAAAGGGGATGAGGGTGG + Intergenic
953066464 3:39476485-39476507 CACAAAAAAGGAAAGGAAGAAGG - Intronic
954435868 3:50495698-50495720 CACACTGAAGGGCAGGAGACTGG - Intronic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
954777023 3:53028711-53028733 CAGAATAAATGGCAGAAAGAAGG + Intronic
956073961 3:65484860-65484882 TACAATAAAGGGCATTAGGAAGG - Intronic
956652896 3:71521528-71521550 AAAAAAAAAGGGCAGGGGGAGGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958041550 3:88231888-88231910 CAGATTAAAGGGGAAGAGGAAGG - Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
959901299 3:111664508-111664530 GAGCATAAAGGGAAGGAGGAAGG + Intronic
960321586 3:116243251-116243273 GAAATTAGAGGGCAGGAGGAAGG - Intronic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
961462564 3:127061834-127061856 CCCAATACAGGGCAGCAGGAAGG - Intergenic
962764475 3:138549013-138549035 CAAAATAAAGGGGTAGAGGAAGG + Intronic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964017281 3:151963201-151963223 AACAATAAAGGTCAGGTGGCAGG - Intergenic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
966866296 3:184260718-184260740 AACAAGAGAGGGCAGGAGGCCGG - Intronic
967486325 3:190035677-190035699 TACACTAAAGGACAGCAGGATGG + Intronic
967680916 3:192362919-192362941 AACAATAGAGGGGAGGAAGAGGG + Intronic
968185704 3:196632513-196632535 CACAATCAGGGGCAGGGGGAGGG - Intergenic
968488023 4:873586-873608 CAGCACAAAGGGCAGAAGGAGGG - Intronic
969145913 4:5123908-5123930 ATCAATAAAAGGCAGGAGGGAGG - Intronic
969359780 4:6656209-6656231 CACATGAAAGGACAGGAGGGAGG - Intergenic
969454890 4:7295146-7295168 GAAAATAAAAGGGAGGAGGAGGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
970298053 4:14652521-14652543 GAAAATACAGGGCAGGAAGAGGG + Intergenic
970645600 4:18117004-18117026 CAGCTTAAAGGGCAGGGGGATGG + Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971635643 4:29053781-29053803 CACAATCATGGGAAGGAGAAAGG - Intergenic
972239875 4:37178795-37178817 CACAACAGAGGGCAGGGAGAAGG + Intergenic
972930451 4:44065673-44065695 CAGAATAAGTGGCAGAAGGAAGG - Intergenic
973050813 4:45593679-45593701 CACATTCAAGGGCAGGAGAACGG + Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974517898 4:62940772-62940794 AACAATATTGGGAAGGAGGAGGG - Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
975836648 4:78429358-78429380 CATAGAAATGGGCAGGAGGAAGG - Intronic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976417251 4:84791686-84791708 CATAATAAAAGGCAGTAAGAAGG + Intronic
977177262 4:93832572-93832594 CTCAGAAAAGGACAGGAGGAAGG + Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
978979158 4:114920365-114920387 AAAAATAAATTGCAGGAGGATGG + Intronic
979450728 4:120867615-120867637 CACAATAAAGGGAAGCAGTTGGG + Intronic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981417514 4:144510120-144510142 CACGATGAAGGGTAGTAGGAGGG - Intergenic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
982964603 4:161888939-161888961 CACAAAACATGGCAGGAGGATGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984179058 4:176458524-176458546 CATAATAGAAGACAGGAGGAAGG + Intergenic
985820552 5:2157297-2157319 CACAAGAAAGGGCAGGTGAATGG - Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987532443 5:19140034-19140056 CAAAATAAAGTGTAAGAGGAAGG + Intergenic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
989398470 5:40983820-40983842 CACAGGAAAGGGCAGGAAGATGG - Intergenic
989400749 5:41005313-41005335 CAAACTAGAGGGCAGGAGGTGGG + Intronic
989786262 5:45334998-45335020 CAAATTAAAGGTCAGCAGGATGG + Intronic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
991444297 5:66682979-66683001 TAGAATAAAGGGCAGGCGAAGGG + Intronic
991530017 5:67604668-67604690 CACATGAAGGGGCAAGAGGAAGG - Intergenic
992278567 5:75148341-75148363 CTCCATAAAGAGGAGGAGGAAGG + Intronic
992376883 5:76197059-76197081 CATGATAATGGGCAGGAGTAGGG - Intronic
992667463 5:79025245-79025267 GAAAATAAAAGGCAGGAGAATGG + Intronic
993310705 5:86328642-86328664 CACAAGTAAGGGCAAGAAGAAGG - Intergenic
993378900 5:87183170-87183192 CAGAGTAAAGGGGATGAGGAGGG + Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993772942 5:91953595-91953617 CAAAATAAAGGTAAGGAGGTAGG + Intergenic
993883164 5:93386477-93386499 GGCAATAAAGGGCAGGGGGCAGG + Intergenic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
995470602 5:112498088-112498110 CAGAAGAAAGGGGAGAAGGAAGG - Intergenic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996506312 5:124271186-124271208 AAGAAGAAAGGACAGGAGGAGGG + Intergenic
996749652 5:126875718-126875740 TTCTATAAAGGGCAGGGGGAGGG + Intronic
998240618 5:140440378-140440400 TACCAAAAAGGGAAGGAGGATGG - Intronic
998427266 5:142039567-142039589 CATAAGACAGGGCTGGAGGAGGG - Intergenic
999406785 5:151313593-151313615 CTCAATGAAGGAAAGGAGGAAGG + Intergenic
999457322 5:151728246-151728268 AACAAAAAAGGGCAGGAGTAGGG + Intergenic
1001220358 5:169895291-169895313 AACAAGAGAGGGAAGGAGGAGGG - Intronic
1001425269 5:171618512-171618534 CCCAGGAAAGGGGAGGAGGAGGG - Intergenic
1002603758 5:180370187-180370209 CACAATGGAGGGCATGGGGAAGG - Intergenic
1003403351 6:5809030-5809052 AACAAGAAAGGACAGGAGGAAGG - Intergenic
1003413353 6:5885744-5885766 CATAAAACAGGGCAGGAGAATGG - Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005968596 6:30744005-30744027 CAGATTAAAGGGCTCGAGGACGG + Exonic
1006243688 6:32709882-32709904 CACAATTAAGGAGAGAAGGAAGG - Intergenic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1007504754 6:42327076-42327098 CACAAGTAAGGGCGGGAGGTGGG + Intronic
1007509841 6:42366477-42366499 CACTCTAACGGGGAGGAGGATGG + Intronic
1008055996 6:46946623-46946645 GGGAATAAAGGGCAGGAGCACGG + Intronic
1008428386 6:51385880-51385902 GACCATGAAGGACAGGAGGAGGG + Intergenic
1008708898 6:54199519-54199541 CACATGAAAAGGCATGAGGAAGG + Intronic
1009567779 6:65334761-65334783 CACAATAAAAGGAGGGAAGAAGG - Intronic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1010940058 6:81906274-81906296 CCCAATACAGGACAGGAGGAAGG - Intergenic
1011275646 6:85628996-85629018 GACAATAAAGGCCAGGAGGAGGG - Intronic
1012756946 6:103243601-103243623 CACACTGAAGGGCATGAGGAAGG + Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014265068 6:119268320-119268342 CAAAATACAGGGAAGGAGCAAGG + Intronic
1014443745 6:121502406-121502428 CACAAAAAAGTGTAGGAAGAAGG + Intergenic
1014721366 6:124921471-124921493 GACAATAAAGGCCAGGCTGAGGG - Intergenic
1015154985 6:130083047-130083069 AACAAAAGAGGGCAGGAGGAAGG + Intronic
1015190000 6:130461883-130461905 CACAATTGTGGGGAGGAGGAGGG - Intergenic
1015515013 6:134074535-134074557 CAAAACAAAAGCCAGGAGGAGGG - Intergenic
1015876853 6:137831173-137831195 TACAAGAAAGGGCAGGGGGAAGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1017537618 6:155365243-155365265 AACAATACAGGTCATGAGGAAGG - Intergenic
1017993093 6:159506899-159506921 GACAAGAAGGGGCAGGAAGATGG - Intergenic
1019795804 7:3047432-3047454 CAGAAAAAAGGACAGGAGGTTGG - Intergenic
1021069955 7:16224402-16224424 CACAATAAAAGGCATGCGAAGGG + Intronic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022004346 7:26253783-26253805 GACAAGAAAGGGAGGGAGGAAGG + Intergenic
1022926021 7:35057030-35057052 TCCAGTAAAGGGCATGAGGAGGG - Intergenic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1026304756 7:69131219-69131241 CACATTCAAGGGCAGAAGAAAGG - Intergenic
1027162659 7:75813817-75813839 CCCCATAAAGGGCAGAGGGAGGG - Intronic
1027453511 7:78359399-78359421 CAAAATACAGGGAAGGAGCAAGG - Intronic
1027624664 7:80531419-80531441 GACAATAAAGTGCAGGCTGAGGG + Intronic
1028522312 7:91745791-91745813 TAGCATAAAGGGCAGGAGGAAGG - Intronic
1028710565 7:93903057-93903079 TCCAATAAAAGGCAGGAGGAGGG - Intronic
1029356847 7:100058400-100058422 GAGATTTAAGGGCAGGAGGAGGG - Intronic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1030693000 7:112553884-112553906 TACAGCAGAGGGCAGGAGGATGG + Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1034136387 7:148774430-148774452 CAAAATAAAGTTCAGGAGAAGGG + Intronic
1034217618 7:149420534-149420556 CACAACACCGTGCAGGAGGAAGG + Intergenic
1035176509 7:157055878-157055900 CACATTAAAGGGCAGGTGACTGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037081654 8:14795106-14795128 CAGAATAAAGGTAAGTAGGAGGG + Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037648059 8:20811680-20811702 AACATTTAAGAGCAGGAGGAAGG + Intergenic
1037694051 8:21208205-21208227 CACAAGGTAGGGCAGGAGAAAGG + Intergenic
1040366985 8:46727687-46727709 CAAAATAAAGGCATGGAGGAAGG + Intergenic
1040879115 8:52185759-52185781 CACAATAAACTCCAGAAGGATGG + Intronic
1041012343 8:53557660-53557682 AACAGTAAAGGGCTGGAGGAGGG + Intergenic
1042122618 8:65505231-65505253 TAAAGTAAAGGGCAGGGGGAAGG - Intergenic
1042408861 8:68438894-68438916 CTCAAAAAAGAGCAGAAGGAAGG + Intronic
1042830297 8:73019533-73019555 AAATACAAAGGGCAGGAGGAAGG - Intronic
1043672864 8:82910490-82910512 CAAATTATAGGGCAGGAGGAAGG - Intergenic
1043797049 8:84555880-84555902 CACTATAAAGAGCAGGTGAAGGG + Intronic
1044935780 8:97292394-97292416 GATCATAAAGGGCAGGGGGATGG + Intergenic
1045165257 8:99597232-99597254 CCCAGTAAATGTCAGGAGGATGG - Intronic
1045367331 8:101488693-101488715 CACAAAGAAGGGCAGGAATAAGG + Intergenic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1047247088 8:123155429-123155451 TACAGTAAAGGGCAGCAGGGCGG + Intergenic
1047402461 8:124558310-124558332 CTCAATCAAGGGCAGGGGGGTGG + Intronic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048468721 8:134688526-134688548 CACGAGAAAGGGGAGAAGGAAGG + Intronic
1049884752 9:19446-19468 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051973447 9:22919838-22919860 GACAGTAGAGGGCAGGAGGAGGG + Intergenic
1052352324 9:27470443-27470465 CAAAAGAAAGGGCAGGGGCAGGG - Intronic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1053264555 9:36701196-36701218 CTGAATAAAGGGCAAGAAGATGG + Intergenic
1053378479 9:37628775-37628797 CACCAGGAAGGGAAGGAGGAAGG - Intronic
1053568251 9:39276053-39276075 CAAAATAAAGGTATGGAGGAAGG + Intronic
1053834225 9:42116807-42116829 CAAAATAAAGGTATGGAGGAAGG + Intronic
1054128892 9:61342957-61342979 CAAAATAAAGGTATGGAGGAAGG - Intergenic
1054596324 9:67070602-67070624 CAAAATAAAGGTATGGAGGAAGG - Intergenic
1055413886 9:76062447-76062469 AAATATAATGGGCAGGAGGAGGG + Intronic
1056859090 9:90163181-90163203 AACAAGAAAGGGCAGGAGGAAGG + Intergenic
1057518146 9:95738665-95738687 TAGATCAAAGGGCAGGAGGAAGG - Intergenic
1057860534 9:98637303-98637325 CACAAGAAAGGGCTTGGGGAGGG - Intronic
1057931287 9:99195845-99195867 TAAAAGAAAGGGAAGGAGGAAGG - Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058775344 9:108277815-108277837 CACCAAAAATGGGAGGAGGAAGG + Intergenic
1058910074 9:109512899-109512921 GACACTTAGGGGCAGGAGGAGGG - Intergenic
1059655684 9:116355256-116355278 AGGAATTAAGGGCAGGAGGAAGG + Intronic
1059855485 9:118392775-118392797 CACAATAAAGGGCAGCACAAGGG - Intergenic
1060975879 9:127764682-127764704 AACAACAAAGAGCAGGAGGGAGG - Intronic
1061247808 9:129410059-129410081 CAAGATGAAGGGCAGAAGGATGG + Intergenic
1062254241 9:135613637-135613659 CACACACAGGGGCAGGAGGATGG + Intergenic
1203489608 Un_GL000224v1:91052-91074 AACAATAGAGGCCAGGAAGAAGG + Intergenic
1203502230 Un_KI270741v1:32940-32962 AACAATAGAGGCCAGGAAGAAGG + Intergenic
1186818814 X:13265311-13265333 CACAAGAATGTGGAGGAGGAGGG - Intergenic
1189567864 X:42261956-42261978 GAGAATAAATGGCAGAAGGAAGG - Intergenic
1190437296 X:50438100-50438122 CTTAATAAAGGGAAGGAGCAAGG + Intronic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1191030792 X:55968218-55968240 AATAAAAAATGGCAGGAGGAAGG + Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1194218835 X:91167090-91167112 CACCATGAAGGGAAGGAGAATGG - Intergenic
1195263622 X:103158936-103158958 TACAATAATGGGCAGAAGGTGGG - Intergenic
1195615258 X:106906748-106906770 CATAACAAATGGCTGGAGGAAGG - Intronic
1196096054 X:111801046-111801068 GACAAGAAAGGGCAGCAAGAAGG - Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196382988 X:115113788-115113810 CACAAGACAGGGGAGGAGTAAGG - Intronic
1197346269 X:125327740-125327762 CACCATCCAGGACAGGAGGAGGG + Intergenic
1197361267 X:125505868-125505890 AAAAATAAAGGACAGGTGGAAGG - Intergenic
1198032563 X:132767705-132767727 CACAATAAAGGGCAGTTGAGAGG - Intronic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1198883884 X:141312174-141312196 CAAAATCAAAGGCAGGAGGAAGG + Intergenic
1200401056 X:156020706-156020728 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
1200555344 Y:4630844-4630866 CACCATGAAGGGAAGGAGAATGG - Intergenic