ID: 1136361837

View in Genome Browser
Species Human (GRCh38)
Location 16:29785626-29785648
Sequence CATGCACAGCCGCTACAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136361833_1136361837 -1 Left 1136361833 16:29785604-29785626 CCAATGAAGACATCAATTAACCC No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data
1136361829_1136361837 14 Left 1136361829 16:29785589-29785611 CCCAGCCTCACCATTCCAATGAA No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data
1136361830_1136361837 13 Left 1136361830 16:29785590-29785612 CCAGCCTCACCATTCCAATGAAG No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data
1136361832_1136361837 4 Left 1136361832 16:29785599-29785621 CCATTCCAATGAAGACATCAATT No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data
1136361831_1136361837 9 Left 1136361831 16:29785594-29785616 CCTCACCATTCCAATGAAGACAT No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data
1136361828_1136361837 27 Left 1136361828 16:29785576-29785598 CCTCTTCTGCAGACCCAGCCTCA No data
Right 1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136361837 Original CRISPR CATGCACAGCCGCTACAAAC GGG Intergenic
No off target data available for this crispr