ID: 1136366849

View in Genome Browser
Species Human (GRCh38)
Location 16:29812947-29812969
Sequence CTTGGGGTGAGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1258
Summary {0: 1, 1: 0, 2: 4, 3: 124, 4: 1129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136366849_1136366858 -1 Left 1136366849 16:29812947-29812969 CCCTCTTCCCTCCTCACCCCAAG 0: 1
1: 0
2: 4
3: 124
4: 1129
Right 1136366858 16:29812969-29812991 GCCTATCTCCTCCTCTTCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 388
1136366849_1136366857 -2 Left 1136366849 16:29812947-29812969 CCCTCTTCCCTCCTCACCCCAAG 0: 1
1: 0
2: 4
3: 124
4: 1129
Right 1136366857 16:29812968-29812990 AGCCTATCTCCTCCTCTTCCAGG 0: 1
1: 0
2: 9
3: 90
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136366849 Original CRISPR CTTGGGGTGAGGAGGGAAGA GGG (reversed) Intronic
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901540262 1:9910629-9910651 CCGGGGGTGAGCAGGGAAGGCGG + Intergenic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902095935 1:13945895-13945917 CTTGGGCAGAGAAGGGAAGCAGG - Intergenic
902399778 1:16151557-16151579 CCAGGGTGGAGGAGGGAAGAGGG + Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903043953 1:20552445-20552467 CGTGGGGGGAGGGGAGAAGAGGG + Exonic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903438754 1:23371305-23371327 CCTGGGGGGAGTGGGGAAGAGGG + Exonic
903474994 1:23613411-23613433 CTAGGGGGCAGGAGGGATGAGGG + Intronic
903667737 1:25018178-25018200 CTAGGGGTGGGGTGAGAAGAGGG - Intergenic
903835347 1:26200062-26200084 CGTGGGATGGGGAGGGCAGAAGG + Intronic
903839083 1:26225498-26225520 CTTGGGGCGGGGAGGGAGGTGGG + Intergenic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904681811 1:32234564-32234586 CTTGGGGTGGGCATGGGAGAAGG + Intergenic
904756470 1:32771185-32771207 CTTGGAGGGAGGTGGGGAGAAGG - Exonic
904810471 1:33160305-33160327 CTTGGGGGTAGGAGGGATGAGGG + Intronic
904823452 1:33259356-33259378 CTTGGGGGGTGGAGGCAAGTTGG + Intronic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
905731034 1:40299747-40299769 GTTGAGGGGAGGAGGGAGGAGGG + Intergenic
905772872 1:40649693-40649715 TTTGTGGTGAGGAGAGGAGAAGG + Intronic
905861613 1:41355629-41355651 CCTGGTGGGAGGAGGGAAGCTGG + Intergenic
906264385 1:44417616-44417638 CGCGGGGCGAGGAGGGAGGACGG - Intronic
906274743 1:44507458-44507480 GGTGGGGTGAAGGGGGAAGAGGG + Intronic
906409839 1:45569595-45569617 ATTGGGGTTGGGAGGGAAGTCGG + Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906614325 1:47224581-47224603 GGTGGGGTGAGGTGGGGAGAGGG - Intronic
906737849 1:48150122-48150144 GTTGGGGGGAGGAGCCAAGATGG + Intergenic
906872526 1:49499510-49499532 CTTGGGGGGAGGCTGGAAGGGGG - Intronic
906927831 1:50138131-50138153 CTTGGTGTGAGGTAGGTAGAGGG + Intronic
907222548 1:52917557-52917579 CATGGGTAGAGGAGGGAGGATGG + Intronic
907358819 1:53898179-53898201 CTTGGGGTGGGTGAGGAAGAGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907464064 1:54623566-54623588 ATTGGGGCGGGGAGGGAGGAGGG - Intronic
907506539 1:54923167-54923189 GTTGGGGTGGGGAGGGAGGGAGG - Intergenic
907546160 1:55261647-55261669 CATGGGGTGGGTAGGGGAGAGGG + Intergenic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908124286 1:61014676-61014698 CCTGGGGTGAGGGGAGAAGATGG + Intronic
908881710 1:68740118-68740140 CTTTGGGGGAGGAGCCAAGATGG - Intergenic
909036694 1:70601260-70601282 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
909277761 1:73709750-73709772 CTTGGGGGAAGGAAGCAAGAAGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910212455 1:84807318-84807340 CTAGAGATGAGGAGGGCAGAGGG + Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910631658 1:89361943-89361965 CTTTCGGTGAGTAGGGCAGATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
910735239 1:90446691-90446713 AATAAGGTGAGGAGGGAAGAAGG - Intergenic
911359511 1:96859344-96859366 CTTGGGCAGAGGAGCCAAGATGG - Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911651859 1:100398132-100398154 CTTGCGGTGAGGACTGAAGGAGG + Intronic
911761286 1:101620185-101620207 CCTGGGGGAAGGAGTGAAGATGG + Intergenic
911869144 1:103070535-103070557 TCTGGGGTTAGGATGGAAGAAGG + Intronic
912488657 1:110048988-110049010 CTTGGGGTGAGTGGGGAGGTAGG + Intronic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912954882 1:114148394-114148416 TTTGGGGTGAGTAGGGAAAATGG - Intronic
912956515 1:114157425-114157447 CTTGGAGGGAGGAGGGAATGGGG - Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914253526 1:145941612-145941634 TTTGTGGAGAGGAAGGAAGATGG + Intronic
914408546 1:147402381-147402403 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
914717637 1:150265639-150265661 CTTGGGGAGAGGAGGGATGCTGG + Exonic
914934496 1:151966576-151966598 CTTGGGGAGAGGTGTGGAGATGG - Intergenic
914983501 1:152437205-152437227 ATTGGGGTGGGGAGCAAAGACGG + Intergenic
915047204 1:153028163-153028185 CTTGGGGGGAAGGTGGAAGATGG - Intergenic
915203962 1:154255331-154255353 TTTGGGGTGAGGATGGAGGTTGG + Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915594905 1:156891203-156891225 TTTGGGGTGGGGAGTGAAAATGG + Intergenic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915924438 1:160005133-160005155 CATGGGGTGGGATGGGAAGATGG - Intergenic
916200910 1:162270986-162271008 CTTGGTGGGAGAAGGGAAGCTGG + Intronic
916850133 1:168695182-168695204 CTTGGGATGAGGAAGGTTGAAGG + Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917118241 1:171623687-171623709 CTTGGGGGGAAGGGGGATGAAGG + Intergenic
917166620 1:172119573-172119595 ATTTGGGTGAGAAGAGAAGAGGG - Intronic
917191317 1:172422229-172422251 CTTTGCTTGAGGAGAGAAGAGGG + Intronic
917453919 1:175169834-175169856 GTCGGGGTGAGGAAGGAAGGAGG - Intronic
918138479 1:181699793-181699815 GTTGGGATGAGAAAGGAAGAAGG + Intronic
918295677 1:183154144-183154166 TCTGGGGAGAGGAGAGAAGAGGG - Intergenic
918583871 1:186163542-186163564 ATTGGGGGGAGGAGCCAAGATGG - Intronic
918738452 1:188096876-188096898 CTAGGGGTGGGGAGGGTAGGTGG - Intergenic
919585278 1:199430817-199430839 CCTGGGGTGAGGAGGTAGGGGGG + Intergenic
919725593 1:200880838-200880860 CTTGGGCTGAGGCAGGAGGATGG - Intergenic
919762400 1:201106312-201106334 CGTGGGGTGAGATGGGAAGCAGG - Intronic
920050586 1:203162371-203162393 TGAGGGGTGAGGAGAGAAGAGGG + Intronic
920051740 1:203168530-203168552 GTTGGGGTGAGAAGGGAAGGTGG - Intronic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920117498 1:203630763-203630785 GTAGGGGTGAGAAGGAAAGAGGG + Intronic
920359800 1:205406842-205406864 ATTGGGGGGAGGAGCCAAGATGG - Intronic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921158437 1:212455791-212455813 TTTGGGGTGAGGTGGGAGGAAGG + Intergenic
921221727 1:212978458-212978480 TTTGGGGCGTGGAGGGAGGAGGG - Intronic
921414926 1:214874673-214874695 CTTGGAGTGAGTAGGTAAGAGGG - Intergenic
921542590 1:216434233-216434255 CTTAGGGTGAAGAGGGATGTAGG + Intergenic
922297755 1:224266485-224266507 CTTGGGGTGATGCAGCAAGAAGG + Intronic
922321988 1:224496536-224496558 CTTGAGATGAGGAGGCCAGATGG + Intronic
922322132 1:224498131-224498153 CTTGAGATGAGGAGGCCAGATGG - Intronic
923126880 1:231040613-231040635 CTAGGGGTGAGCCGGGAAGCTGG - Intergenic
923126913 1:231040721-231040743 CTGGGGGTGAGCCGGGAAGCTGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923453078 1:234137928-234137950 GTTGGGGTGAGTGGGGCAGAGGG + Intronic
923544652 1:234915252-234915274 GTTGTGGGGAGGAGAGAAGAGGG - Intergenic
923846135 1:237734743-237734765 CCTGGGGTGAAGAGAGAAGAAGG + Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924638718 1:245812946-245812968 GTTGGGGTGAGGAGGTGAGGAGG + Intronic
924642822 1:245850049-245850071 CTTGGGGTTTGGGGGGAAAAAGG + Intronic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
1062922599 10:1291481-1291503 TTTGCTGTGAGGAGGGAACATGG - Intronic
1063353166 10:5374481-5374503 CTTGCTGTGGGGAGGGAGGAAGG - Exonic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063961315 10:11307652-11307674 GTTGGGGAGATGAGGGAACAAGG + Intronic
1064365741 10:14706333-14706355 CTTGGGGGGCTGAGGCAAGAGGG - Intronic
1065061889 10:21910654-21910676 CCTGTGGTGGGGTGGGAAGAGGG + Intronic
1065282770 10:24156662-24156684 CCTGGGGTGATTAGGGAAGGTGG - Intronic
1065439002 10:25729893-25729915 CTGGTGGTGAGGTGGGAGGATGG + Intergenic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066088394 10:31993760-31993782 CATGGGCAGAGAAGGGAAGATGG - Intergenic
1066253000 10:33652371-33652393 CCTGGGGAGAGGAGGGAATAGGG - Intergenic
1066444941 10:35473779-35473801 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1066455743 10:35569881-35569903 CTTGGGGTGAGGAATAAGGAGGG - Exonic
1066487197 10:35858665-35858687 CTTAGGGGGAGGAGCCAAGATGG + Intergenic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067613812 10:47744422-47744444 TTGGGGGGGAGGGGGGAAGAGGG + Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067752128 10:48978450-48978472 CTTGGGCTGAGGTGGAGAGAGGG - Intronic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1068226123 10:54108736-54108758 CTTCTGCTGAGGAGAGAAGAGGG + Intronic
1068737710 10:60432953-60432975 CTTTGGCTGAGGATGGAAAAAGG - Intronic
1069742502 10:70693995-70694017 CTTGGGGACAGGCAGGAAGAAGG - Intronic
1069815089 10:71188612-71188634 ATTAGGGTGAGGAGGGTAGGAGG + Intergenic
1070098811 10:73365625-73365647 GCTGGGAAGAGGAGGGAAGAGGG + Intergenic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070464187 10:76703284-76703306 CTTCGCATGAGGAGAGAAGAGGG + Intergenic
1071815568 10:89229314-89229336 CCAGGGGTTAGGAGGGAGGAAGG + Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1071992150 10:91110180-91110202 CTTGGGGTGAGCAGGAAAAAGGG + Intergenic
1072222148 10:93335584-93335606 CTTGGCGTGAGCAGGGAGGCAGG + Intronic
1072222156 10:93335638-93335660 CTTGGCGTGAGCAGGGAGGCAGG + Intronic
1072625636 10:97109563-97109585 AATGGGGTGAAGAGGGAAGATGG - Intronic
1072706173 10:97682620-97682642 ATTGAGGTGAGGAGCGGAGAAGG - Intronic
1072712122 10:97722679-97722701 CATGGATTAAGGAGGGAAGAAGG - Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073056693 10:100707739-100707761 TTTGGGGTGAGGATGGAAATGGG - Intergenic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073434153 10:103506094-103506116 GTTGGGGTAAGGACGGAAAAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074124934 10:110521355-110521377 CTTGGGATGCGAAGGGAGGACGG - Intergenic
1074585310 10:114762618-114762640 GTAAGGGTGAGGAGGGAAGGTGG - Intergenic
1074781282 10:116804134-116804156 TTTGGAGGGAGGAGGGAGGAAGG - Intergenic
1074794851 10:116932468-116932490 CATGGACTGGGGAGGGAAGAGGG - Intronic
1074803461 10:117025660-117025682 CTTGAGGAGAGGAGAGGAGAGGG + Intronic
1075394743 10:122119129-122119151 TCTGGGGAGAGAAGGGAAGAAGG - Intronic
1075536845 10:123278600-123278622 CTTGGTGTGATGAGGTATGATGG + Intergenic
1075582635 10:123633893-123633915 CTTGAGATGAGGAGGGCATAAGG + Intergenic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1075831540 10:125416303-125416325 CATGGGGTGAAGAGGGGAGTGGG - Intergenic
1075934536 10:126328082-126328104 CTAGGGGCCAGCAGGGAAGATGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076091543 10:127690421-127690443 CATGGGGGAAGGTGGGAAGAAGG + Intergenic
1076260185 10:129059007-129059029 CCTGGTGTGAGGAGGGACAAGGG + Intergenic
1076347989 10:129793822-129793844 GGTGGGGTGAGGTGGGGAGAAGG - Intergenic
1076508451 10:130994260-130994282 TTTGGGGTGGGGAGGGCAGGGGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077915824 11:6611003-6611025 CTTGCGGTCCTGAGGGAAGAGGG + Exonic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1077999932 11:7485504-7485526 ATTGGGGTGGGGGGTGAAGATGG - Exonic
1078003976 11:7518604-7518626 TCTGGGGTGAGGGTGGAAGAGGG + Intronic
1078012584 11:7584373-7584395 ATTGAGGGGAGGAGGGAATAAGG + Intronic
1078105760 11:8357079-8357101 CCTGCCGGGAGGAGGGAAGAGGG - Intergenic
1078621692 11:12914562-12914584 CTTGGGGTGGGTGGGGAAGCTGG - Intronic
1078754513 11:14196307-14196329 CTTGTGGATGGGAGGGAAGATGG + Intronic
1079128834 11:17735892-17735914 GCTGGGGGGAGGGGGGAAGAGGG + Exonic
1079272331 11:19000109-19000131 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079407125 11:20156839-20156861 GTCGGGGTGGGGAGAGAAGAGGG + Intronic
1079549395 11:21675052-21675074 CTTGAGGGGAGGAGCCAAGATGG - Intergenic
1080271991 11:30460284-30460306 TTTGGGGTGAGGGGGAAAGTTGG - Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080479963 11:32637578-32637600 TTTGGGGGCAGGAGGGGAGAGGG - Intronic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080856419 11:36115661-36115683 CTTGAGGTGAGGAGGGACTGGGG - Intronic
1081197504 11:40179110-40179132 CTTGGGAGGACGAGGCAAGAAGG - Intronic
1081489177 11:43554135-43554157 GTTGGGTTGAGGAGGGAGGAGGG + Intergenic
1081677339 11:44978209-44978231 TGTGGAGTGAGGAGGAAAGAGGG + Intergenic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083331998 11:61903044-61903066 ACTGGGGGGAGGAGAGAAGAGGG - Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083431319 11:62614850-62614872 CTTGGGGTGAGGAAGAGGGAGGG + Exonic
1083570489 11:63758992-63759014 CTTGAGGTGGGCAGGGGAGAGGG - Exonic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083630133 11:64091078-64091100 CATGGGAGGAGGAGGGGAGAAGG + Intronic
1083805919 11:65073886-65073908 ATGGGTGTGAGGAGGGATGAAGG - Intronic
1083971740 11:66081407-66081429 GTTGGGGGGGGCAGGGAAGACGG - Intronic
1084518927 11:69651082-69651104 GGTGGGGAGAGGTGGGAAGAGGG - Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084793983 11:71491975-71491997 CCTGGGGTCAGGAGGGAGGTAGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1085691737 11:78669807-78669829 CATGGGGCGAGTAGTGAAGAAGG - Exonic
1086436169 11:86782885-86782907 CTTGGGGTGGGGAGTGGAGAAGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087159327 11:94933951-94933973 CATGGGGTGAGGGGAGCAGATGG - Intergenic
1087612522 11:100451855-100451877 TTTGGGGGGAGGAGCCAAGATGG + Intergenic
1087936251 11:104037203-104037225 CTTGGCGTCAGGAGAGAAGGTGG + Exonic
1088103325 11:106177818-106177840 CTTGAGGTGAGGAGGGGGGTTGG - Intergenic
1088105310 11:106200722-106200744 CTTGGGGTGAAAAAGGTAGAAGG + Intergenic
1088673570 11:112167867-112167889 CTTGGGGAGAGAAGAGAAGGGGG + Intronic
1088746421 11:112808379-112808401 CCTGGGGTGAGGAGGGGAGGAGG - Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089402614 11:118173083-118173105 CTGGAGGTGAGGAGTGATGAGGG - Intronic
1089505306 11:118958347-118958369 CTAGGGGAGAGGAGGGCAGGAGG - Exonic
1089531278 11:119131497-119131519 CTTGGGGTGAGGACTGAGGGTGG - Intronic
1089614428 11:119687255-119687277 TCTGGCGTGAGGAAGGAAGAGGG - Intronic
1089645459 11:119875937-119875959 CCTGGGCTGAGCAGGGAAGCAGG + Intergenic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1090934651 11:131330652-131330674 ATTGGAGTGAGGAAAGAAGAGGG + Intergenic
1091108223 11:132942857-132942879 GCTGGGGAGAGGAGGGAAGAGGG - Intronic
1091285793 11:134408195-134408217 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285815 11:134408277-134408299 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285827 11:134408318-134408340 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285839 11:134408359-134408381 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285852 11:134408400-134408422 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285864 11:134408441-134408463 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285876 11:134408482-134408504 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285888 11:134408523-134408545 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285900 11:134408564-134408586 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285912 11:134408605-134408627 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285924 11:134408646-134408668 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285936 11:134408687-134408709 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285948 11:134408728-134408750 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285960 11:134408769-134408791 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285972 11:134408810-134408832 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285984 11:134408851-134408873 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285996 11:134408892-134408914 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091286009 11:134408933-134408955 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1091410134 12:233677-233699 GGTGGGGAGAGGAGGGGAGAAGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091580272 12:1783047-1783069 CTTGAGGTCAGGAGCCAAGATGG - Intronic
1091650830 12:2308001-2308023 CATGGGTGGAGGTGGGAAGAGGG - Intronic
1091828245 12:3531286-3531308 CTTGCCTTGGGGAGGGAAGAGGG + Intronic
1091943119 12:4508892-4508914 CCTGGGGGGAGGAGCCAAGATGG + Intronic
1092618824 12:10240166-10240188 CTTGGGGGGCTGAGGTAAGAAGG - Intergenic
1092713466 12:11363284-11363306 CTTGGGGAGAAGAGAGAATATGG + Intronic
1092944187 12:13437786-13437808 TGTGGGGGGAGGGGGGAAGAGGG + Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1094119893 12:26960652-26960674 TTTGGGGTGTGGATGGAAGGGGG + Intronic
1094762182 12:33546691-33546713 ACTGGGGTGGGGAGGGAAGGGGG + Intergenic
1094770397 12:33651639-33651661 GTTGGGGGTAGGAGGGAAAAGGG + Intergenic
1095083240 12:38031430-38031452 CTGGGGGCGAGGAGCCAAGACGG + Intergenic
1095340927 12:41087467-41087489 TTTGGGGGGAGGAGCCAAGATGG - Intergenic
1095654009 12:44648289-44648311 TTTGGGCTGAGGGAGGAAGAAGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095854445 12:46844625-46844647 GTAGGGCAGAGGAGGGAAGATGG + Intergenic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1096921191 12:55087389-55087411 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1096927776 12:55167598-55167620 ATTGGGGGGAGGAGCCAAGATGG - Intergenic
1097054127 12:56239890-56239912 ATAGGGGTGAGGAAGGAAGAGGG + Exonic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097805579 12:63961373-63961395 CTGGGGGTGAGGAAAGAAGGGGG - Intronic
1098014626 12:66091459-66091481 CTTGAGGTGAGGTGGGAGGGTGG - Intergenic
1098434946 12:70458720-70458742 GTTAGGGTGAGAAGGCAAGAAGG + Intergenic
1098484517 12:71005252-71005274 CATGGGGTGGGGAGGAAATAGGG - Intergenic
1098767625 12:74509523-74509545 GTTGGGGGGAGGAGCCAAGATGG - Intergenic
1098957945 12:76706848-76706870 TTTGGGGAGAGGAAGGAAGAAGG + Intergenic
1099614696 12:84919575-84919597 CTTGTGGTGGGGAGGGGGGAAGG - Intergenic
1100226097 12:92557291-92557313 CTTGAGGAGATGAGCGAAGAAGG + Intergenic
1100289580 12:93201011-93201033 AGTGGGGTGAGGATGCAAGAGGG - Intergenic
1100712089 12:97268554-97268576 CTGGGGGTGATGGTGGAAGAAGG + Intergenic
1100911408 12:99367128-99367150 CGTGGGGAGAGGAGTGAGGAGGG + Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101729193 12:107412702-107412724 AGTGGGGTGAGGTGGGAGGAAGG + Intronic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1101897912 12:108769790-108769812 CTTGGGCTGAGGGGGCAGGAAGG - Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102343337 12:112141048-112141070 CTTGGGGTCAGGATGGAATCTGG + Exonic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102738455 12:115184299-115184321 GGTGGGGTCAGGAGGAAAGAGGG + Intergenic
1102750051 12:115285119-115285141 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1102980540 12:117237529-117237551 CTCGGGGGGAGAAGGGAATAGGG - Intronic
1103153643 12:118664012-118664034 CATGGGGTGTGGAGCCAAGATGG - Intergenic
1103157211 12:118696185-118696207 CTAGGGTAGAGAAGGGAAGATGG - Intergenic
1103487833 12:121295425-121295447 TGTGGGGTGATTAGGGAAGAGGG + Intronic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1103960421 12:124605942-124605964 GTAGGGAAGAGGAGGGAAGAGGG - Intergenic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105716977 13:23076500-23076522 CTTTGGGTGAGATGGAAAGAAGG + Intergenic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1105881356 13:24609037-24609059 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1106243166 13:27925842-27925864 CTGGGGGTGAGGGAGAAAGATGG + Exonic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106523139 13:30516016-30516038 CCGGGGGTGAGGGGGGAAGGTGG - Intronic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107484185 13:40810724-40810746 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107619298 13:42209105-42209127 CTTGGGCTAAGGAGGGTTGAAGG + Intronic
1107629701 13:42330861-42330883 CTTGGAGAGAGGAGGCGAGATGG - Intergenic
1107639234 13:42424877-42424899 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1107671791 13:42753812-42753834 CCTGGGAGGAGAAGGGAAGAGGG + Intergenic
1107992394 13:45830188-45830210 CTAGGGATGAGAAGAGAAGAAGG - Intronic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1108450876 13:50561823-50561845 CTTGGTGGGAGGAGTAAAGAAGG + Intronic
1108474341 13:50798882-50798904 GGTGGAGTGAGGAGGGAAGGAGG - Intronic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110328242 13:74241952-74241974 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1110376684 13:74802402-74802424 CTTGAGGAGAGGAGAGGAGAGGG + Intergenic
1110738495 13:78966460-78966482 AGTGGGGTGAGGAGTGAATAGGG - Intergenic
1110975614 13:81830259-81830281 CTTGGGGGGAGGATGGGAGACGG + Intergenic
1111799260 13:92961613-92961635 CTTGGGGTGAAGAAAGAAGTGGG - Intergenic
1112191679 13:97184473-97184495 CCAGGGGTGAGGGGGGAACACGG - Intergenic
1113439850 13:110319814-110319836 CTTGGGAGGAGAAGGGAAGAGGG - Intronic
1115832420 14:37356915-37356937 CCTGGGGGGAGGAGCCAAGATGG - Intronic
1116162530 14:41288327-41288349 CTTGGGCTAAAGACGGAAGAAGG + Intergenic
1116222742 14:42110443-42110465 CTAGGGGATAGGAGGCAAGATGG + Intergenic
1116486357 14:45453358-45453380 TCAGGGGTGAGGAGGGATGAAGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117237628 14:53795211-53795233 CTTGGGGTGAGATGGCATGAGGG - Intergenic
1117264985 14:54077206-54077228 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1117385134 14:55204318-55204340 GTAGTGGTGAGGAGGGAAGTGGG - Intergenic
1117968339 14:61228396-61228418 CTTGCTATGAGGAGGGAGGAGGG - Intronic
1118067839 14:62211414-62211436 TTTGGGGAGAGGGGGGTAGAGGG - Intergenic
1118105327 14:62652726-62652748 TTTGGGGTGGGGAGAGATGAGGG - Intergenic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1118366446 14:65101696-65101718 CAAGGGGTGGGGAGGGAGGAAGG - Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119210577 14:72828656-72828678 CATGGGGTGAGGAGCAATGAAGG + Intronic
1119339363 14:73863193-73863215 GGTGGGGTGAGGAGGGGAAATGG - Intronic
1119506338 14:75176316-75176338 CGTGGGGCCGGGAGGGAAGACGG - Intronic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120602147 14:86523986-86524008 TTTGGGGTGTGGGGGGAGGAGGG + Intergenic
1120961908 14:90132592-90132614 GTTGGGAGGAGGAGGGAATAGGG + Intronic
1121299717 14:92860888-92860910 CTTGGGCTGAGGTGGGGGGATGG - Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121556317 14:94840418-94840440 CTTGGGGTGTGCAGGGAGGTGGG + Intergenic
1121623183 14:95364415-95364437 CCTGGGGTGTGGGGGGAGGAGGG + Intergenic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122084031 14:99287171-99287193 GCTGGGGGGAGGAGGGAAAATGG - Intergenic
1122137734 14:99644682-99644704 GTAGGGGTGGGGAGGGAGGACGG - Intergenic
1122211137 14:100174922-100174944 GTTGGGGAGAGGGGGAAAGAAGG - Intergenic
1122491777 14:102122114-102122136 TTTGGAGTGAGGAGGGAAGTAGG + Intronic
1122616039 14:103018667-103018689 GTTGGGGTGAGGAGGGGAGTAGG + Intronic
1122695891 14:103551908-103551930 CATGGGGTGAGGAGGACTGAGGG - Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122854645 14:104554275-104554297 CCTGGGGTGAGGAGACAGGAGGG + Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122918236 14:104868570-104868592 CTTGGGGCCAGGAGGGTAGGGGG + Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123413889 15:20081351-20081373 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123523231 15:21088462-21088484 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123683028 15:22776023-22776045 CATGGGGTGGGGAGGGAGGTGGG + Intronic
1123758372 15:23414523-23414545 TTTGGGGTGAGGTGGGGAGATGG - Intergenic
1123763059 15:23447146-23447168 CATGGGGTGGGGAGGGAGGTGGG + Exonic
1123798012 15:23793471-23793493 CCTGGGGTGAGGAGAGCAGCTGG - Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124042540 15:26118546-26118568 CCTGGGGTGATGTGGGAAGGGGG + Intergenic
1124212672 15:27776341-27776363 GTGGGCGTGAGGTGGGAAGATGG - Intronic
1124411511 15:29441300-29441322 CCTGGGGAGAGGAGGGAATGTGG + Intronic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1124844326 15:33275723-33275745 CCTGGGGAGAGGAGAGGAGAAGG - Intergenic
1125200415 15:37097359-37097381 CTTAGGGGGAGTAAGGAAGATGG - Intronic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125301194 15:38254352-38254374 TTTGGGGTGGGGAGGGAGTAAGG - Intronic
1125582745 15:40798336-40798358 GCTGGGGGGAGGAGGGAACAGGG + Intronic
1126505077 15:49395980-49396002 CTGGGGGCGAGGAGCCAAGATGG + Intronic
1126658476 15:51006985-51007007 GTTGGGGGCAGGAGGGCAGAAGG - Intergenic
1126979887 15:54228751-54228773 CTTGAGGAAAGGAGGGGAGAGGG - Intronic
1127381642 15:58435481-58435503 AGTGGGGTGGGGAGGGAATAGGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127531533 15:59847930-59847952 GTTGGGGAGAGGTAGGAAGAAGG + Intergenic
1127921363 15:63496970-63496992 ATTAGGGTTAGGAAGGAAGAGGG + Intergenic
1127964863 15:63915946-63915968 CTTGGGGTGTGAGGGGGAGATGG + Intronic
1128327989 15:66737565-66737587 AATGGGGTGAGGAGGAAAGACGG - Intronic
1128338719 15:66805014-66805036 CTTGGGCTGGGGTGGGATGAAGG + Intergenic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128654667 15:69451980-69452002 CTTGGGGGAAGGAGGGATTATGG - Intergenic
1129036709 15:72654751-72654773 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129213178 15:74082474-74082496 CATGGGGTGGGGAGGGAGGTAGG + Exonic
1129317371 15:74753167-74753189 GTTGTGCTGAGGAGGGAAGAGGG - Exonic
1129397221 15:75258612-75258634 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129400833 15:75282889-75282911 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129424665 15:75454801-75454823 CTTGGGGTGGGCGGGGAAGCAGG + Intronic
1129451946 15:75656102-75656124 GCTGGGATGAGGAGGGAACAGGG + Intronic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129696417 15:77742953-77742975 CTTGGGGTGCGGTGAGAGGATGG + Intronic
1129780778 15:78269255-78269277 GCTGGGGTGAGGAGGGCACATGG + Intronic
1129794201 15:78363614-78363636 CCTTGAGTTAGGAGGGAAGACGG + Intergenic
1129838210 15:78727190-78727212 CGTGGGGTGGGGAGGGAGGCAGG - Intronic
1130070089 15:80639830-80639852 CTTGTAGTGAAGAGGGAGGATGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130721277 15:86387737-86387759 CTTGGGGACAGCAGGGAGGAAGG - Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130989778 15:88869471-88869493 CTTGGGGTGAGGATGGAGGGTGG - Intronic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131187961 15:90291974-90291996 CATGGGGTGTGGAGGGAGGCGGG - Intronic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1131549192 15:93342039-93342061 CCTGGGGGGATGAGAGAAGAGGG + Intergenic
1131841554 15:96442653-96442675 CTGGGTGTTAGGCGGGAAGAAGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132290495 15:100698877-100698899 TTGGGAGTGAGGTGGGAAGATGG - Intergenic
1132351876 15:101144707-101144729 CATGGGCTGAGAAGGAAAGAAGG + Intergenic
1132362126 15:101225171-101225193 TTGGAGGTGAGGTGGGAAGATGG - Intronic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133042546 16:3068158-3068180 CCTGGGGAGAGGAGGGCACAGGG - Exonic
1133316760 16:4889805-4889827 CTTGGGGTGAGGGAGGAACACGG - Intronic
1133435417 16:5775306-5775328 CTTGAAGGGAAGAGGGAAGAGGG - Intergenic
1133813193 16:9177246-9177268 GGAGGGGAGAGGAGGGAAGAGGG - Intergenic
1134082191 16:11332665-11332687 CTTTGGGAGAGTAGGGAAGGAGG + Intronic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134363740 16:13557168-13557190 TTAGGGGAGAGGAAGGAAGAGGG - Intergenic
1134457966 16:14408358-14408380 TTTGGGGTGAGGTGGGGAGATGG + Intergenic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135667563 16:24348956-24348978 CTAGGGGTGAGGAGAGAGGAAGG - Intronic
1135730887 16:24894306-24894328 CTTGGGGTGGGAAAGGAGGAGGG - Intronic
1135943498 16:26843258-26843280 ATTGGCAGGAGGAGGGAAGAAGG + Intergenic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136676044 16:31906907-31906929 TTTGGGGGGAGGAGCCAAGATGG - Intronic
1137002684 16:35243911-35243933 CATGGGGTAAGGTGGGAGGATGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137677521 16:50311103-50311125 CTAGTGGTGGGGAGGGAAGGAGG + Intronic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138205058 16:55118667-55118689 GGTGGGGTGAGGAGAGCAGAAGG + Intergenic
1138363968 16:56457380-56457402 GCTGGGGGGAGGAGAGAAGAGGG + Intronic
1138503801 16:57466083-57466105 CTGGGGGTGAGGCTGGAAGGAGG - Intronic
1138973199 16:62170979-62171001 CTTGGGGTCACAAGGGCAGAGGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139954058 16:70685100-70685122 CTTGGGAGGAGGCGGGATGAAGG - Intronic
1140344562 16:74200291-74200313 CTTGGGGTCAGGAAGGGGGAAGG + Intergenic
1140393225 16:74606509-74606531 CTGGGAGTGAGGAGCAAAGAGGG + Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141639110 16:85330834-85330856 CCTGGGGTAAGAAGGGAGGAGGG - Intergenic
1142399536 16:89852080-89852102 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399551 16:89852119-89852141 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399568 16:89852158-89852180 GGTGGGGAGAGGATGGAAGATGG - Intronic
1142399581 16:89852197-89852219 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399598 16:89852236-89852258 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399613 16:89852275-89852297 GGTGGGGAGAGGATGGAAGATGG - Intronic
1142399626 16:89852314-89852336 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399642 16:89852353-89852375 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399659 16:89852392-89852414 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399676 16:89852431-89852453 GGTGGGGAGAGGATGGAAGATGG - Intronic
1142399689 16:89852470-89852492 GGTGGGGGGAGGATGGAAGATGG - Intronic
1142399723 16:89852548-89852570 GGTGGGGAGAGGACGGAAGATGG - Intronic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142688457 17:1591186-1591208 TTTGGGGTGAGGTGGGAATGGGG + Intronic
1142766549 17:2067660-2067682 CATGGGGAGGGGAAGGAAGACGG + Intronic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143344506 17:6240038-6240060 GTTGGGGTGAGGGGGGAGGCAGG - Intergenic
1143447391 17:7017565-7017587 CATGGGCCGAGGAGAGAAGAGGG - Intergenic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1144576942 17:16435423-16435445 CTTGGGGTGTGAAGGGACTAAGG - Intronic
1144764727 17:17726148-17726170 CTTGTGGCCCGGAGGGAAGAGGG + Intronic
1144805324 17:17962237-17962259 GCTGGGGGGAGGAGGGAACAGGG + Intronic
1144871600 17:18375618-18375640 CCTGGGGAGAGGAAGGGAGAGGG - Intergenic
1145018487 17:19413471-19413493 TCTGGGGTGAGGATAGAAGATGG + Intronic
1145806139 17:27732398-27732420 CTTGGGTTGAGGATGGGAAAGGG + Intergenic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1145879710 17:28344342-28344364 CCTGGGGTTAGGGAGGAAGAAGG - Exonic
1145969576 17:28949298-28949320 CCGGGAGGGAGGAGGGAAGAGGG + Intronic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146477993 17:33178583-33178605 CTTGAGGTCAGGAAAGAAGATGG + Intronic
1146528506 17:33587663-33587685 CTTGTAGTGAGCAGAGAAGAAGG + Intronic
1146644778 17:34569896-34569918 CTTGGCCTGGGGAGGGAAGGGGG + Intergenic
1146744074 17:35313138-35313160 TTTGGGGTGAGGAGGTTAGGGGG + Intergenic
1146788303 17:35736491-35736513 CCTGGGGTCAGGAGGAAAGATGG + Intronic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1147718458 17:42523157-42523179 CCTGGAGGGAGGAGTGAAGAGGG - Intergenic
1147966451 17:44196875-44196897 ATTGGGATGAGGTGGGAAGCAGG - Intronic
1148088849 17:45010528-45010550 CTTGGGGTGGGGAGCGAGCAGGG + Intergenic
1148109850 17:45138170-45138192 TTTGGGGAGAGGAGGGAGGGCGG - Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148458141 17:47821846-47821868 CTTGGCGGGAGGAGGGGACAGGG - Intergenic
1148503001 17:48106188-48106210 CAAGGGCTGAGGAGGGAGGATGG + Intronic
1148648910 17:49235462-49235484 CTTGCGGGGAGCAGGGAGGAGGG + Intergenic
1148703227 17:49604660-49604682 GTTGGCGTGAGGATGGGAGAAGG - Intronic
1148819901 17:50354338-50354360 GTGGGGGTGAGATGGGAAGAGGG - Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149066474 17:52486322-52486344 TTTGGGGTGAGGGGTGAAGGAGG + Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149299856 17:55295184-55295206 AATAGAGTGAGGAGGGAAGATGG + Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149558029 17:57588100-57588122 TTTGGGGGGAGGGAGGAAGAAGG + Intronic
1149573692 17:57696211-57696233 CATGGCGGGAGGAGGGAGGAAGG - Intergenic
1149930173 17:60744113-60744135 CTTGGGGAGAAGAGCGAACAGGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150550311 17:66203861-66203883 CCTGGGGAGAGGAGAGAGGAGGG + Intergenic
1150923339 17:69506202-69506224 CTTGGGTTGAGATGGAAAGATGG + Intronic
1151083771 17:71357882-71357904 TTTGGGGAGAGGAGACAAGATGG - Intergenic
1151549285 17:74812673-74812695 CTTGGAGTGAGGAGGGCGCAGGG - Intronic
1151629496 17:75300940-75300962 CGTGGGGAAAGGAGGGAAAAAGG - Intergenic
1151803376 17:76390812-76390834 CTTGGGGAGAAGAGGGCAGTGGG + Exonic
1151983221 17:77526445-77526467 CTTGCGGGGAGGAGTGGAGAGGG - Intergenic
1151996101 17:77610016-77610038 AAGGGGGTGAGGAAGGAAGAGGG + Intergenic
1152003756 17:77664098-77664120 CTTTGGATGAGGAGTCAAGATGG + Intergenic
1152041896 17:77909013-77909035 CTTGGGGTGAGGTGTGGGGAGGG - Intergenic
1152070239 17:78130698-78130720 CATGGGGTGAGAGGGGAGGAGGG + Intronic
1152213937 17:79021311-79021333 CTTGGGAAGAGGAGGGAAGGAGG - Intergenic
1152310680 17:79547985-79548007 GATAGGGTGAGGAGGGAAGCTGG - Intergenic
1152763634 17:82122933-82122955 CTTGGGGAGAGGATGGGAGATGG - Intronic
1152913045 17:83016497-83016519 GATGGAGGGAGGAGGGAAGAGGG + Intronic
1152942611 17:83180873-83180895 GTTGGTGTGAGGCGGGGAGAAGG + Intergenic
1153037938 18:782069-782091 GTTGGGGAGAGGAGAGAAAATGG - Intronic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153289183 18:3483516-3483538 TGTGGGGAGAGAAGGGAAGATGG + Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1155297229 18:24396678-24396700 CTTGGGGTGGGGAGGGAGGGGGG + Intronic
1155533319 18:26789995-26790017 CTTTGTGTGAGGAGGCATGAAGG + Intergenic
1155548538 18:26940355-26940377 CTTGGGGTTAGGATTGGAGATGG + Intronic
1155595777 18:27484492-27484514 CTTGGAATGAGGAGCGAAAAAGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156455180 18:37289163-37289185 CGTGGGGTGAGAAGGGATGGGGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157688564 18:49662473-49662495 CATGGCCTGAGGAGGGGAGAGGG + Intergenic
1158260531 18:55601323-55601345 CTTGGGAAGAGGTGGGCAGATGG - Intronic
1158286888 18:55893421-55893443 CCTGGGGGGAGGAGACAAGATGG - Intergenic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160538283 18:79606975-79606997 CATGAGGTGAGGAAGGAAGACGG + Intergenic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1161942457 19:7414175-7414197 ATGGGAGTGAGGGGGGAAGAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162573429 19:11485417-11485439 CGCGGGGATAGGAGGGAAGATGG + Intronic
1162716301 19:12636625-12636647 CTTGGGGAGGGGAGGGCAAAGGG - Intronic
1162834378 19:13306716-13306738 CTTGGGGTGATTAGGGCAGGTGG - Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163057418 19:14731081-14731103 CTTGGGGGGAGGGGGCAGGAGGG - Intronic
1163102480 19:15106945-15106967 CTTGGGGTGGGGTGGGTAGTGGG + Intergenic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163509111 19:17724933-17724955 CGTGGGGTGAGGACAGGAGAGGG + Intronic
1163590403 19:18190575-18190597 ATTGGGGGAAGGAAGGAAGAAGG + Intergenic
1164274304 19:23703249-23703271 CTTGGGGTGGAGAGAGAATATGG + Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164805651 19:31114502-31114524 CTTGGGGTGAGAAATGAACAAGG + Intergenic
1165218097 19:34291522-34291544 CTTGGGGTGATGCAGTAAGAAGG - Intronic
1165316594 19:35059991-35060013 CGTGTGGTGAGGAGGGCAGCGGG + Exonic
1165461394 19:35946053-35946075 CATGGGGTGGGGCAGGAAGATGG + Intergenic
1166159431 19:40940936-40940958 GATGAGGAGAGGAGGGAAGAGGG + Intergenic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166398661 19:42461707-42461729 ATTAGGGTGGGGAGGGAGGAGGG - Intergenic
1166816822 19:45551277-45551299 CTTGGGGTGAGGAGGAATAGTGG + Intronic
1166956473 19:46468760-46468782 TTTGGGGGGAGGGGGGAACAGGG + Intronic
1167153227 19:47722267-47722289 CATGGGGCGGGGAGGGAAGAAGG - Intronic
1167454877 19:49592790-49592812 TTTGGGGGGTGGAGAGAAGAGGG - Intronic
1167503608 19:49860422-49860444 CTTGGGGAGAGCAGAGCAGAGGG + Exonic
1167579467 19:50333172-50333194 CTTGGGGTGAGTACGGGGGAGGG - Intronic
1167801355 19:51744686-51744708 CTGGAGGTGAGGAGATAAGAGGG + Intergenic
1167972356 19:53196579-53196601 CCTGGGGTGTGGAGCGAGGAGGG + Intergenic
1168165112 19:54541856-54541878 CCTGGGCTGAGAAGGGACGAGGG + Intronic
1168394723 19:56038301-56038323 CCAGGGGTGAGGAAGGAAGTTGG + Intronic
1168519399 19:57036519-57036541 CGTGAGGAGAGGAGGGAAGACGG + Intergenic
925042610 2:744615-744637 CCGGAGGTGAGAAGGGAAGAGGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925250504 2:2432559-2432581 CATGGGGTGGGGAGGGGGGAAGG + Intergenic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
925969027 2:9094148-9094170 GTGGGCGTGAGGTGGGAAGAAGG - Intergenic
925981202 2:9178882-9178904 TTTGGGGTGCTGAGGGGAGAAGG + Intergenic
926135509 2:10332959-10332981 CTTGGGGTGAGGGGTGCAGGGGG + Intronic
926658704 2:15439496-15439518 CTTGAGGGGAGGAGCCAAGATGG + Intronic
926686527 2:15702725-15702747 CTTGGGGTGATTAGGGCAGGTGG - Intronic
926688900 2:15719207-15719229 CAAGAAGTGAGGAGGGAAGACGG + Intronic
927042955 2:19247893-19247915 CTGGGGGTGAGCAGAGATGAGGG + Intergenic
927436362 2:23069754-23069776 CTTGGGGCGGTGAGGGGAGAGGG + Intergenic
927519808 2:23691902-23691924 CTTGGGGGGAAGAGTGCAGATGG + Intronic
927561102 2:24074590-24074612 CCTGGGATGGGCAGGGAAGAGGG - Intronic
927617891 2:24618576-24618598 TTTGGGGTGAGGAGAGGTGAAGG + Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927859549 2:26551943-26551965 TTTGGGGTGAGGAAGTAGGATGG + Intronic
927872051 2:26629928-26629950 CTTGGGTTGAGGATGGAAATTGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928295540 2:30079747-30079769 CGTGGGGTGAGGAGAGGGGAGGG + Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928692036 2:33810144-33810166 CTTGGCGTGAGGAGGTATGTGGG + Intergenic
928764971 2:34635308-34635330 CTTGGGGGGTGGAGCCAAGATGG + Intergenic
928911816 2:36429613-36429635 TTTAGGGGGAGGAGAGAAGATGG + Intronic
929433643 2:41909783-41909805 CCTGTGGTGAGAAGGGAGGAGGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929474394 2:42231307-42231329 CTTGGAGTGAGAAAGGAATAGGG - Intronic
929544356 2:42846074-42846096 AGTGGGGTGAGGTGGGGAGATGG + Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930019023 2:46989979-46990001 CTTGCGGTGGAGTGGGAAGAAGG + Intronic
930530294 2:52580934-52580956 CTTGGGGAGAGGCTGGGAGAGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932301979 2:70673935-70673957 CTTGGGGTGAGGAATGGAGATGG + Intronic
932368588 2:71169225-71169247 CCTGGGATGATGAGGGCAGAGGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932577895 2:72972729-72972751 TTTGGGGGGAGGAGTGAAGCAGG - Intronic
932819292 2:74886058-74886080 AGTGGGGTGAGGAGAGCAGATGG + Intronic
933689893 2:85171914-85171936 TGTGGGGGGAGGGGGGAAGATGG - Intronic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935538092 2:104317819-104317841 CATGGGGAGAGGAAGGAAGCAGG + Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
936018564 2:108977614-108977636 CTTGGAGTGAGGAGGGACTGGGG + Intronic
936519857 2:113204858-113204880 GTCGGGGTGAGGGGGGCAGAGGG + Intronic
936632039 2:114214362-114214384 CTTGGGGTGGGGAAGAAGGAAGG - Intergenic
936754063 2:115683327-115683349 CTCGGGATTAGGATGGAAGAAGG + Intronic
937071124 2:119064335-119064357 AGTGGGGTGAGGAGTGGAGAGGG - Intergenic
937114700 2:119397026-119397048 CTTGGGCTGAGTACGGAGGAAGG + Intergenic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937882990 2:126882438-126882460 CTTGGGGTGAGAGGGGGATAAGG - Intergenic
937978015 2:127593365-127593387 GTTGGGGTGAGGAGGGAACTCGG - Intronic
937980006 2:127609262-127609284 CGTGGGGCCAGGAGGGGAGAGGG + Intronic
938108431 2:128548861-128548883 CTTGGAGTGAGGAGAGGAGCTGG - Intergenic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938240854 2:129741411-129741433 TTTGGGGTGACTAGGGAAGGGGG + Intergenic
938603679 2:132870009-132870031 CTTGGGCTGAGGAGGGATTTAGG - Intronic
938672061 2:133596179-133596201 CATGGAGTGATGAGGGAGGAAGG - Intergenic
939173841 2:138726950-138726972 CCTGGGGTGAGCAGGGAGGGAGG - Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
939995034 2:148911980-148912002 GTTGGGATGGGGAGGAAAGAGGG - Intronic
940259520 2:151765735-151765757 GTTGGGGTGAGGAGGAGGGAAGG - Intergenic
940465827 2:154025298-154025320 CATGGGGGGAGGAGCCAAGATGG - Intronic
941065047 2:160892438-160892460 CTTGAGGGGAGGAGGGAAAGAGG - Intergenic
942166590 2:173246706-173246728 ATTGGGGAGAGGAGGAAATAAGG - Intronic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942326055 2:174778076-174778098 CTTGGGGATGGCAGGGAAGAAGG - Intergenic
942410584 2:175704860-175704882 CCTGGGGAGAGGAGCCAAGATGG - Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
943882883 2:193170701-193170723 ATTGGGGGGAGGAGCCAAGATGG + Intergenic
944264706 2:197710535-197710557 CTTGGGGGGTGGGGGGAAGGGGG - Intronic
944366597 2:198928275-198928297 ATTGGGGTGGGGGAGGAAGAGGG - Intergenic
944645814 2:201780541-201780563 CGTGGGTGGAGGCGGGAAGAGGG + Intronic
945474320 2:210263587-210263609 CTTGGGGGGCTGAGGCAAGATGG + Intergenic
945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG + Intergenic
945981641 2:216317042-216317064 CTTGGGCTGAAGAGGTTAGAAGG - Intronic
946076446 2:217077529-217077551 CTTGAAGTGAGCAGAGAAGAGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946397398 2:219449805-219449827 CCTGAGGTGAGGAGGCTAGAAGG - Intronic
947190253 2:227497159-227497181 TGTGGGGTGGGGGGGGAAGAGGG - Intronic
947232697 2:227903694-227903716 CTTGGGCTGGGGTGGGAGGAAGG - Intronic
947306655 2:228755690-228755712 ATTGGGGGGAGGAGCCAAGATGG + Intergenic
947721002 2:232369270-232369292 CTTGGGCAGAGGAGGGCAGTGGG - Intergenic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
947926384 2:233925831-233925853 CTTTGGGAGACGAGGGGAGAGGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948420982 2:237859784-237859806 CTAGGGGAGAGGAGGGGAGCGGG + Intronic
948696906 2:239737367-239737389 GTTGGGGTGCGGCAGGAAGAGGG - Intergenic
948856353 2:240732253-240732275 CATGAGGGGAGGAGGGATGAAGG + Intronic
949033160 2:241805964-241805986 CTTGGGCTGAGGGGGGAGGGAGG - Intergenic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169074137 20:2751177-2751199 CTTGGGCTGGGGCGGGAGGATGG - Intronic
1169460193 20:5787632-5787654 CCTGGTGTGAGTAGGGAATAAGG + Intronic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170938270 20:20827971-20827993 AATGGAGTGAGGAGGGAGGAAGG + Intergenic
1171053931 20:21887652-21887674 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1171391093 20:24802294-24802316 GTTGGGATGAGTATGGAAGAGGG - Intergenic
1172030001 20:31975109-31975131 CCTGGGGAGAGGAGGGAGGATGG + Intronic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172611270 20:36254434-36254456 CCTGGTGGGAGGAGGGAAGGGGG + Intronic
1172637932 20:36422526-36422548 TTTGGACTGAGGTGGGAAGAAGG + Intronic
1172751791 20:37256597-37256619 CTTGGGGTGAGTGGGACAGATGG - Intronic
1172997295 20:39080557-39080579 CTTAGGGAGAAGAGGGAAGGTGG + Intergenic
1173342058 20:42161616-42161638 CTTGGCCTGAGGAGGGCAGAGGG + Intronic
1173344266 20:42184449-42184471 AGTGGGGAGGGGAGGGAAGAAGG - Intronic
1173362097 20:42353947-42353969 CAGGGGCTGAGGTGGGAAGATGG + Intronic
1173476549 20:43363909-43363931 CTCCGGGTGAGATGGGAAGAAGG - Intergenic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173581461 20:44149611-44149633 GTTGGGGGGAAGAGGGCAGAAGG - Intronic
1173584529 20:44172262-44172284 ATTGGGGTGAGAAGGAAAAAGGG + Intronic
1173705541 20:45107761-45107783 CATGGGGTGGGGAGGGGAAAGGG + Intergenic
1173935580 20:46859421-46859443 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174376548 20:50129975-50129997 CTTGGGGTGGGGAGGAAGGGCGG - Intronic
1174411692 20:50340669-50340691 TTTGTGGTGAGAAGGGAAGAAGG + Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175229626 20:57465531-57465553 CTTGGGGTGTGGATGTAGGAAGG + Intergenic
1175453956 20:59095641-59095663 TTTGGGGTGAGGATGGGAGTAGG - Intergenic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1176317247 21:5257682-5257704 GTTGGGGGGAGGAGCCAAGAAGG - Intergenic
1176636603 21:9249657-9249679 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
1176942960 21:14946228-14946250 CAAGGGGTGAGGAAGGAAAAGGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1177820595 21:26027158-26027180 CTTGCACTGATGAGGGAAGAGGG + Intronic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178407316 21:32335270-32335292 ATTGAGGTGAGGTGGGCAGAGGG - Intronic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1179121177 21:38547292-38547314 ATTGGGCTGGAGAGGGAAGAAGG + Intronic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180565479 22:16660383-16660405 TATGGGGTGAGGAGACAAGATGG + Intergenic
1180815982 22:18789843-18789865 CTTGGGGGGAGGGGGGAGGGGGG + Intergenic
1180917416 22:19498916-19498938 CTTGAGGTGAAGAGGTTAGAAGG - Intronic
1181202169 22:21224178-21224200 CTTGGGGGGAGGGGGGAGGGGGG + Intronic
1181436516 22:22914324-22914346 CTTGGGGAGACCAGGGAAGGAGG - Intergenic
1181443844 22:22953268-22953290 CTTGGAGTGATGAGGGCAGGTGG + Intergenic
1181527776 22:23500043-23500065 GTGGAGGTGAGGCGGGAAGAGGG - Intergenic
1181690637 22:24557442-24557464 TGTGGGGTGAGGAGGAATGATGG - Intronic
1181744512 22:24946527-24946549 CCTGAGGTGAGGAGTGAGGAGGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182151248 22:28028607-28028629 CTTGAGGTAGGAAGGGAAGAAGG + Intronic
1182546230 22:31078217-31078239 CCTTGGGTCAGGAGGCAAGAAGG - Intronic
1182791923 22:32960286-32960308 CCTGGGGTGATCAGGGCAGATGG - Intronic
1183109365 22:35637714-35637736 CTTAGGGTGGGGTGGGAGGATGG - Intronic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183290377 22:36998423-36998445 CCTGGAGTGAGGAGAGAGGAAGG + Intronic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183358316 22:37371028-37371050 CCTGGGGCGAGGAGGGGAGGGGG - Exonic
1183361327 22:37384733-37384755 ATTGGGGTCAGGTGGGGAGAGGG - Intronic
1183382313 22:37496367-37496389 CATGGGGTGGGGAGGGACCAAGG - Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183720772 22:39560189-39560211 CTTGGGGTGTGGGGTGAAGGTGG - Intergenic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184285958 22:43471656-43471678 GCTGCGGAGAGGAGGGAAGAGGG - Intronic
1184363966 22:44037537-44037559 CTTGGTGTGAGGAGTAAACAAGG - Intronic
1184580323 22:45412923-45412945 CTTCGGATGAGAAGGGAAAAGGG + Intronic
1184598332 22:45527586-45527608 GTTGGGGTGGGGAGGGGAGGTGG + Intronic
1184947486 22:47813830-47813852 GATGGGGTGCGCAGGGAAGAGGG + Intergenic
1185123765 22:48991774-48991796 GTTGGGGGGAGGAGCCAAGATGG - Intergenic
1185150927 22:49163632-49163654 CATGGGGAGAGGAGGCAGGAAGG + Intergenic
1185182754 22:49372663-49372685 CTCGGAGTGCGCAGGGAAGAAGG - Intergenic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
1203224740 22_KI270731v1_random:71250-71272 CTTGGGGGGAGGGGGGAGGGGGG - Intergenic
1203266085 22_KI270734v1_random:15535-15557 CTTGGGGGGAGGGGGGAGGGGGG + Intergenic
950334668 3:12183835-12183857 CTTGGGGGGAGGAGAGGAGTTGG - Intronic
950469608 3:13176412-13176434 CTAGGGGTAAGGGTGGAAGAAGG - Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950944501 3:16930694-16930716 CTTGAGATTAGGAGGGATGATGG - Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951088281 3:18540476-18540498 CTTGGGGTGGGAAGGGAGAAAGG + Intergenic
951550164 3:23869484-23869506 CTTGGGGTGAGGGGGCAGGCAGG - Intronic
951717677 3:25665492-25665514 TTTGGGGTGAGGGGAGGAGACGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952812141 3:37413595-37413617 CTTGAGGGGAGGAGGGTAGTTGG + Intronic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953667640 3:44937366-44937388 CCTGGGGTGGGGAGAGGAGACGG + Intronic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954013360 3:47663164-47663186 GTAGGGGAGAGGAGGGGAGAGGG + Intronic
954380722 3:50217654-50217676 CCTGGAGTGGGGAGGGATGAGGG - Exonic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954793467 3:53149327-53149349 CCTGAGGGGAGGAGGGAAGGGGG - Intergenic
954937906 3:54343727-54343749 CTTGGGCTGTGGGGGGTAGAGGG - Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955255201 3:57324577-57324599 CCTGGGGGGAGGAGCCAAGATGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956596369 3:70971707-70971729 CTTGGGGTGGGGAGAGAGGGGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957104160 3:75865607-75865629 CTGGGGGTGATGAGAGAAAATGG + Intergenic
959418821 3:106109502-106109524 TTTGGGGTGAGGGGGGAGGGAGG - Intergenic
959464140 3:106665290-106665312 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
959556112 3:107720357-107720379 CTTGTGCTGGGGAGGGAAGTGGG + Intronic
960499726 3:118422693-118422715 CTTGGGGCGGGGAGTGAAGCTGG - Intergenic
960878573 3:122321602-122321624 CTTGTGGTGAAGAGGGAAAGTGG - Intergenic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961763679 3:129191191-129191213 CTTGGGGTGAGGGTGGTTGAAGG - Intergenic
961991324 3:131195254-131195276 CATGGGGTGAGGTTGGAGGAGGG - Intronic
962161551 3:133005644-133005666 CATGGGGGGAGGAGCCAAGATGG - Intergenic
962230356 3:133660244-133660266 CTTGGGGTGGGAAGAGAAGGGGG - Intronic
962246678 3:133801159-133801181 TTTGGGGAGCGGATGGAAGAAGG + Intronic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963358662 3:144242243-144242265 TTTGGGGAGAAAAGGGAAGATGG + Intergenic
963556927 3:146803513-146803535 CTTGGGGTGGGGATGGGAAAAGG + Intergenic
964208238 3:154198720-154198742 CTTGGGGAGAAGGGGGAAAAGGG + Intronic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
965692671 3:171374215-171374237 ATTGGGGTAAGGAGGATAGAGGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
967233075 3:187359256-187359278 CTTGAGGTGAAGCTGGAAGAGGG - Intergenic
967285193 3:187862477-187862499 CATGGGGGGAGGAGCCAAGATGG + Intergenic
967287794 3:187890217-187890239 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
968137212 3:196228093-196228115 CCTGGGGTGGGGAGAGAAGAGGG - Exonic
968186654 3:196637431-196637453 CTTGGGATGTGGAGGGAATGGGG + Intergenic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
1202750292 3_GL000221v1_random:155362-155384 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
968520732 4:1033673-1033695 CCTGGGGTCAGGAGGGAATGGGG - Intergenic
968830997 4:2933025-2933047 CATGGGGTTAGGTGGGGAGAGGG - Intronic
969414127 4:7047786-7047808 CTTGGGGTGAGGGAGGAAGCTGG + Intronic
969477788 4:7431253-7431275 CAAGGGGTGGGTAGGGAAGAGGG + Intronic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
970147681 4:13053948-13053970 CTTGGGGTGAAGAGTGACCAAGG - Intergenic
970695339 4:18670279-18670301 CATGGCGTGAGGAGAGAGGAAGG + Intergenic
970860390 4:20696103-20696125 CCTGGGGGGAGGATGGAGGATGG - Intergenic
971507458 4:27381701-27381723 CTTCGGGGGAGGAGCCAAGATGG - Intergenic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
972475172 4:39443361-39443383 TTTGGGGGGAGTAGGGAGGAGGG - Intronic
972672363 4:41225946-41225968 CTTGGGGGAAGGGGGGAATAGGG + Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
972790544 4:42367594-42367616 ATTGGGGTGGGGACAGAAGAGGG + Intergenic
972807547 4:42545617-42545639 TCTGGGGTGAGGAGGGAACGCGG - Intronic
974435136 4:61846835-61846857 GGTGGGGTGGGGCGGGAAGAAGG + Intronic
974727245 4:65812785-65812807 CTTGGGGAGAGAAGGCAGGATGG - Intergenic
974821207 4:67068505-67068527 ATTGGGGGGAGGAGCCAAGATGG - Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975062488 4:70019658-70019680 TTTGGGGGGAGGAGCCAAGATGG - Intergenic
975252150 4:72192873-72192895 GGTGGGGTGGAGAGGGAAGAAGG + Intergenic
976443188 4:85100584-85100606 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
976529372 4:86134668-86134690 ATTGGGGGGAGGAGCCAAGATGG + Intronic
977353228 4:95914756-95914778 ATTGGGGGGAGGAGCCAAGATGG + Intergenic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
977836238 4:101648633-101648655 ACTGGGGTGAGGTGGGAAGAAGG + Intronic
978659675 4:111109295-111109317 CATGGGGTGATGTGAGAAGAAGG + Intergenic
979227191 4:118300116-118300138 CTTGGGGGGATGAGGTGAGAGGG - Intronic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
979589889 4:122465977-122465999 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
979675350 4:123403274-123403296 CATGGGGTGAAGAAGGAAGGTGG - Exonic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
980984868 4:139685317-139685339 CATGGAGTGGGGAGGGAGGAAGG + Intronic
981332832 4:143532669-143532691 TTTGGGGGGTGGAGGGAATAAGG - Intronic
981815674 4:148828501-148828523 AATGAGGTGAGGAGGGAAAAGGG - Intergenic
981822507 4:148902042-148902064 CCTGGGCTGAGGAGGGAAAAAGG + Intergenic
982046283 4:151449682-151449704 CTTGGGGAAAGGATGGGAGAGGG - Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983140278 4:164141804-164141826 GTTGGGGGGAGGAGCCAAGATGG + Intronic
983224889 4:165076570-165076592 CCTGGGGGCAGGAGGGTAGAGGG - Exonic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984307534 4:178015027-178015049 TTTGGGGGGAGGAGCCAAGATGG + Intergenic
984337870 4:178415614-178415636 TTAGGGGTGAGGAGGGGAGTGGG - Intergenic
984438638 4:179736846-179736868 CTTGTGGTGGGGTGGGAGGATGG - Intergenic
1202751491 4_GL000008v2_random:8096-8118 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
985743659 5:1634420-1634442 CGTGGGCTGAGGCGGGAGGATGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985802075 5:2011095-2011117 ATTGCAATGAGGAGGGAAGAAGG + Intergenic
986393630 5:7306557-7306579 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
986471563 5:8081542-8081564 CTTGGGGCAAGGAAGGCAGAGGG + Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986616116 5:9619020-9619042 CTTGGGAAGAGGATGGTAGATGG - Intergenic
987029098 5:13959621-13959643 CTTGGGGTAAGGAATGAAGAGGG - Intergenic
987163173 5:15166391-15166413 CTTGGGGTGAGGTAGGAGGTGGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988874584 5:35429964-35429986 GTTGGGCTGAGGTGGGAGGAAGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989550864 5:42734711-42734733 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
989779199 5:45243985-45244007 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
990529492 5:56659604-56659626 CGTGGGCTGAGTAGGGAAGGAGG + Intergenic
991028729 5:62059671-62059693 GTTGTGGTGAGAAGGAAAGATGG - Intergenic
991354271 5:65751344-65751366 CTTGTGATGATGAGGGAAGATGG + Intronic
991555360 5:67889601-67889623 CCTGGGGGGAGGAGCCAAGATGG + Intergenic
991659704 5:68938015-68938037 GTCGGGGTGGGGTGGGAAGAGGG - Intergenic
992222538 5:74586996-74587018 ATTGAGGAGGGGAGGGAAGATGG + Intergenic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994845844 5:104987410-104987432 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
994963056 5:106628793-106628815 CTTGGAGGGAGGAGCCAAGATGG - Intergenic
995820460 5:116224535-116224557 CATGGTGAGAGGAGGGAACAAGG + Intronic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
996111417 5:119570702-119570724 CTTGGGGTGAGGGGGCACAAAGG + Intronic
996118410 5:119644321-119644343 CCTGGGCTGAGGATGGAGGAAGG - Intergenic
996205863 5:120734271-120734293 ACAGGAGTGAGGAGGGAAGAGGG + Intergenic
996386571 5:122915279-122915301 CTCAGGGTGAATAGGGAAGATGG - Intronic
996467722 5:123823249-123823271 CTTGGAGTGAGGAGGGGGGTTGG - Intergenic
997256841 5:132435569-132435591 GGTGGGGTGAGGTGGGCAGAAGG + Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997468252 5:134102328-134102350 TTTGGGGTGGGGGGGGTAGAGGG - Intergenic
997716932 5:136049417-136049439 CCTGTGGGGAGGAGAGAAGATGG - Exonic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
998136359 5:139676457-139676479 CTTGGGGGGAGGTGGGGAGGAGG - Intronic
998453135 5:142250005-142250027 CCTGGGGTGAGGTGGGAGGAAGG + Intergenic
998489575 5:142534569-142534591 GCTGGTGTGAGGAGGGCAGAAGG - Intergenic
998629051 5:143878304-143878326 ATTGGGGTGTGGTGGGGAGATGG - Intergenic
999103751 5:149050392-149050414 CATGGAGTGAGAAGGGGAGATGG - Intronic
999157723 5:149470419-149470441 CTTGGGGTAAGGAGTGGAGGTGG + Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999375657 5:151084983-151085005 CTTAGGCTGAGGAGAGAAGCTGG - Intronic
999491613 5:152056723-152056745 CTTGGGGCAAGGTGGCAAGATGG + Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
1000656375 5:163884148-163884170 GATGGGGTGAGGTGGGAAGTGGG + Intergenic
1001499791 5:172221684-172221706 CATGGGGTTAGGAGGGAGGCAGG + Intronic
1001927161 5:175646321-175646343 CATGGGGTGATGTGGGAAGAAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1002888793 6:1317033-1317055 CTGGGGGGGAGGCGGGAGGAGGG - Intergenic
1003170521 6:3718518-3718540 CCTGGGGTGATTAGGGTAGATGG - Intergenic
1003457930 6:6300750-6300772 CTCGGGGGGAGGAGCCAAGATGG - Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004008844 6:11661702-11661724 CTAGTGGGGAGGAGGGAAGTAGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004190784 6:13461747-13461769 CCTGGGGTGAGGTGGGATGATGG - Intronic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1004909374 6:20268228-20268250 CTGGTGGTGAGAAGAGAAGAAGG + Intergenic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005650285 6:27879312-27879334 CTTGGGACAAGGAGGGAAGGTGG + Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005984738 6:30864337-30864359 CATGGAGTGGTGAGGGAAGAAGG - Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006116266 6:31777563-31777585 CTGGGGGTGAGGGGTGAAGCTGG + Exonic
1006184815 6:32175775-32175797 GATGGGAGGAGGAGGGAAGAGGG - Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007450838 6:41939702-41939724 CTTGGGCTAAGGGGGGAAGAGGG + Intronic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1007697760 6:43744534-43744556 CTTGGAATGAGGGAGGAAGATGG + Intergenic
1007791517 6:44311552-44311574 CATGGGGTGGGGGGGGAAGACGG + Intronic
1007872921 6:45062444-45062466 GTAGGGGTGAGGAGCCAAGATGG + Intronic
1007881761 6:45176058-45176080 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1007939461 6:45765478-45765500 AAAGGGGAGAGGAGGGAAGAAGG - Intergenic
1007967762 6:46017738-46017760 GTTGGGGTGAGGAGAGGAAAAGG + Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008248832 6:49212013-49212035 CTTGGGGAGAGGTGAAAAGATGG + Intergenic
1008437744 6:51496010-51496032 CCTGGGGTGACTAGGGCAGAGGG + Intergenic
1008548610 6:52605829-52605851 GGAGGGGAGAGGAGGGAAGAAGG - Intergenic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1009826597 6:68873753-68873775 CTTGGGGTGAGGGATTAAGAAGG + Intronic
1010130090 6:72482069-72482091 CTTGGAGTGAAGGGGGAATAGGG - Intergenic
1010654487 6:78496099-78496121 TTTGGGGTGAGGAAGAAAGGTGG - Intergenic
1010746319 6:79566064-79566086 CTTGGGGTGAGGAGGATGGAGGG + Intergenic
1010919294 6:81662042-81662064 ATTGGGGTGGGGTGGGATGAGGG + Intronic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011999696 6:93637591-93637613 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1012215097 6:96572774-96572796 CTTATGGTGAGGAGGTAAGCAGG - Intronic
1012297711 6:97545843-97545865 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1012434812 6:99204278-99204300 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1012665394 6:101962035-101962057 CTTGGGTTCATGAGGGCAGAGGG + Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013077370 6:106783184-106783206 TTTGCGCTGAAGAGGGAAGAGGG + Intergenic
1013217367 6:108040010-108040032 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
1013488668 6:110622437-110622459 CTTGGGGTTAAGAAGGATGAAGG + Intronic
1013591190 6:111620694-111620716 CTTGGGGGAACGAAGGAAGAAGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014090641 6:117400172-117400194 CATGAGGTGAGGAGAGAAAAGGG - Intronic
1014548133 6:122756076-122756098 GTTGGGGAGAGGAGGGGAAAGGG - Intergenic
1015296751 6:131603586-131603608 CTTGGGGGTAGGAGGAAACAAGG - Intronic
1015684557 6:135845278-135845300 CTTAGAGTGAGGAGAGAAGAGGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016519980 6:144936183-144936205 CCTAGGGTGAGGAGGGGATAGGG + Intergenic
1016653324 6:146487958-146487980 TTTGGGGTGGGGAGGGACGGAGG + Intergenic
1017085161 6:150706899-150706921 TTTGGTGAGGGGAGGGAAGAAGG - Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017999895 6:159569837-159569859 CTTGGGGAGAGTAGGGGGGATGG - Intergenic
1018153722 6:160965507-160965529 CTTGGGGGGTTGGGGGAAGATGG - Intergenic
1018331123 6:162728032-162728054 CTAGGGGCGGGGCGGGAAGAGGG - Intronic
1018429684 6:163713378-163713400 GTTGGGGGGAGGAGGGGAGACGG - Intergenic
1018558153 6:165071862-165071884 GATGGGGTGAGCAGGGGAGAAGG + Intergenic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018844679 6:167547393-167547415 GATGGGGTGAGGAGGGAGGAGGG - Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1019017642 6:168891417-168891439 CTTGGTGTCAGAAGAGAAGAGGG + Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019462234 7:1166573-1166595 CTTGTGGTCAGCAGGGAAGAAGG + Intergenic
1019476410 7:1246770-1246792 ATTTGGGAGAGGAAGGAAGATGG + Intergenic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019735371 7:2647650-2647672 CGTGGGGCGGGCAGGGAAGAGGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019869988 7:3751453-3751475 GGTGGGGGGAGGAGGGAGGAGGG + Intronic
1020104141 7:5413369-5413391 GATGGGGAGAGGAGGGAAGGAGG - Intronic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1021245174 7:18252912-18252934 CTGGGGTGGAGGATGGAAGAGGG - Intronic
1021961512 7:25877805-25877827 CTCTCGGTGAGGAGAGAAGAGGG + Intergenic
1022038206 7:26554096-26554118 CCTGTGGATAGGAGGGAAGATGG - Intergenic
1022089125 7:27096383-27096405 CGAGAGGTGAGAAGGGAAGAGGG + Intergenic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022734555 7:33063389-33063411 CTGGGGGTGAGGAGGGGCGCAGG + Intergenic
1023167319 7:37355699-37355721 CCTGTGGTCAGGAGGGAAAATGG - Intronic
1023201146 7:37698312-37698334 CATGGTGGTAGGAGGGAAGAAGG - Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1024954802 7:54906157-54906179 ATTGGGGTGTGGTGGGAACAGGG + Intergenic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1025839845 7:65136184-65136206 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025883221 7:65559781-65559803 CTTGGGGTGGGGTGGGGGGAGGG + Intergenic
1025890225 7:65642825-65642847 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026184208 7:68069286-68069308 GTTGGGGTGAGGGGGAGAGAAGG + Intergenic
1026282336 7:68933091-68933113 CCTGGAGTGAGCAGGGTAGAGGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026323602 7:69288621-69288643 TTTGGGGTGGAGAGGGAAGTGGG - Intergenic
1026734458 7:72940906-72940928 CTTGGGGCCAGGAGGGAGGTGGG - Exonic
1026784790 7:73295814-73295836 CTTGGGGCCAGGAGGGAGGTGGG - Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026909280 7:74083337-74083359 CTTGGGGAGGGGAGGGAGGCGGG - Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027109286 7:75424114-75424136 CTTGGGGCCAGGAGGGAGGTGGG + Exonic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1027892603 7:83995324-83995346 ATTGGGGGGAGGAGCCAAGATGG - Intronic
1028867810 7:95733709-95733731 CTTGGGGTGGGGTGGGAACAAGG + Intergenic
1029206142 7:98870261-98870283 TTTGGGGTGGGGAGGGATGCGGG - Intronic
1029241345 7:99165366-99165388 CCTGAGCTGAGGAGGAAAGAGGG + Intergenic
1029599073 7:101553332-101553354 CCTGGCGTGAAGGGGGAAGAAGG + Exonic
1029919053 7:104242919-104242941 TTTGGGGAGGGGAAGGAAGATGG + Intergenic
1029989885 7:104953364-104953386 CTTGGGAGGAGGTGGGAGGATGG - Intergenic
1030246745 7:107391090-107391112 CTTGGTGGGAGGAGGGGGGAGGG + Intronic
1030966137 7:115995195-115995217 CATGGGGTGGGGAGGGGGGAGGG + Intronic
1031115846 7:117667571-117667593 CATGGGGAGAGGAGAGAAAAAGG - Exonic
1031127799 7:117793997-117794019 CTTGGGGTGAGGGGGGGTGCAGG - Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031478650 7:122252140-122252162 CTTGGGGTCAGGAGGGACCTGGG + Intergenic
1031617069 7:123894493-123894515 GTTGGGGGGAGGAGCCAAGATGG + Intergenic
1032487704 7:132300573-132300595 CTTGGGGTGGGCACAGAAGAAGG - Intronic
1032539998 7:132695001-132695023 CTTGGAGTGCGCAGAGAAGAAGG - Intronic
1032859112 7:135860994-135861016 CTTGTGGAGAGGAGAGAAGAGGG + Intergenic
1032948093 7:136874581-136874603 CTTGGATTTGGGAGGGAAGAGGG - Intronic
1033371620 7:140714211-140714233 CTTGTGGGGAGGAGCCAAGATGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034471720 7:151258214-151258236 GTTGGGGTGAGGCTGGAAGCAGG - Intronic
1034569180 7:151941455-151941477 CATGGGGTGGGGAGGTAGGAGGG - Intergenic
1035271521 7:157722684-157722706 ACAGGGGTGAGGAGGGAAGGAGG + Intronic
1035587144 8:785491-785513 CCTGAGGGGAGGAGGGAAGCTGG - Intergenic
1035587154 8:785525-785547 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035587213 8:785692-785714 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035791336 8:2307976-2307998 CTTGTGGGGAGGAGCCAAGATGG - Intergenic
1035801469 8:2413729-2413751 CTTGTGGGGAGGAGCCAAGATGG + Intergenic
1036620784 8:10423499-10423521 CTTGGGGTGGGGCGGGGAGGGGG + Intronic
1037826678 8:22164388-22164410 CTTGGGGAGAGGATGGGAGTGGG + Exonic
1037836884 8:22219882-22219904 CTTGGGGAGAGGTGTGGAGAAGG - Exonic
1037929213 8:22867639-22867661 CTTGGGGTGGGGTTGGAGGAGGG - Intronic
1038066094 8:23965302-23965324 TTTGGGGTGGGGAAGGTAGAGGG - Intergenic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038642276 8:29338099-29338121 TTGGGAGGGAGGAGGGAAGATGG - Intronic
1038654683 8:29438505-29438527 CCTGGGGTGATTAGGGGAGATGG - Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1038709026 8:29923464-29923486 GTTGGGATGGGGAGTGAAGAGGG - Intergenic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039124084 8:34181171-34181193 CTTGGGGGGAAGAGTGAAGGGGG + Intergenic
1039418997 8:37420122-37420144 CTAGAGGTGAGGAGGCTAGAGGG - Intergenic
1039445033 8:37624213-37624235 CGTGGGCTGAGCAGGGAAGGGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040016198 8:42702227-42702249 CATGGGCAGAGGAAGGAAGATGG - Intronic
1040405842 8:47100962-47100984 TTTGGGGGGAGGAGCCAAGATGG - Intergenic
1040554598 8:48467838-48467860 CCTGGGGTGATGAGGGCAGGTGG + Intergenic
1040591817 8:48799912-48799934 CATGGGGGGAGGAGCCAAGATGG - Intergenic
1041021484 8:53642969-53642991 CTTGGGGAGAGGAGAGCAGAAGG - Intergenic
1041157535 8:55004026-55004048 TTTGGGGGGAGTGGGGAAGAGGG - Intergenic
1041310333 8:56510172-56510194 GGTGAGGTGAGGTGGGAAGAGGG - Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042040347 8:64582127-64582149 TTTGGGGTGGGGAGGGAGGGAGG + Exonic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042395580 8:68287951-68287973 GTTGGGGTGAGGGAGGAGGATGG + Intergenic
1042476011 8:69247909-69247931 CTAGGAGTGAGGAGAGGAGATGG - Intergenic
1042678480 8:71350738-71350760 CTTGGAGTAAGGAGTGAGGAAGG - Intronic
1042874761 8:73431042-73431064 CTTGGGGAGTTGTGGGAAGAAGG + Intronic
1043042028 8:75275642-75275664 CTTGAGGAGAGGAGAGGAGAGGG + Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1043984755 8:86680782-86680804 TGTGGGGTGAGGAGGGGAGGTGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044517401 8:93155236-93155258 CTTGGTGTGAGTAGGGCAAATGG + Intronic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045388098 8:101690186-101690208 CTTGTGGAGAGGAGGGGAGGGGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046458567 8:114504027-114504049 TTTGGGGGGAGGAGCCAAGATGG + Intergenic
1047051899 8:121122114-121122136 CTTGTTGTGGGGTGGGAAGAGGG - Intergenic
1047220925 8:122917450-122917472 CATGGGGTGGGGAGAGATGAGGG - Intronic
1047741470 8:127810183-127810205 CCTGGGGAGAGGAAAGAAGAGGG - Intergenic
1047804330 8:128343638-128343660 GTTGGGGGGAGGAGCCAAGATGG + Intergenic
1048297073 8:133222287-133222309 CATGGGGTGAAGAAGAAAGAGGG + Intronic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1048471321 8:134706726-134706748 CTTGGGGTGAGGAGCAGGGATGG + Intronic
1048547655 8:135402714-135402736 ATTGGGGTGGGGAGAGTAGAGGG - Intergenic
1048627010 8:136196204-136196226 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
1048657860 8:136562168-136562190 CGTGGTGTGAGGAGGGGGGAGGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048916827 8:139192616-139192638 CATGGGGTAAGGAGGGAATGAGG + Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049950067 9:635174-635196 CATGAGGTCAGGATGGAAGAGGG - Intronic
1051060284 9:13037880-13037902 CTTGGAGGGAGGAGCCAAGATGG + Intergenic
1051473167 9:17473077-17473099 CTTGGGTTCAGGTGGGAAGTAGG - Intronic
1051669250 9:19493815-19493837 GTTCCGATGAGGAGGGAAGATGG + Intergenic
1051873010 9:21760702-21760724 GTTGGGGTGGGGATGGAATATGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052398480 9:27971291-27971313 CTTTGGGTGAGAGGGAAAGATGG - Intronic
1052562676 9:30106861-30106883 ATTGGGGGGAGGAGCCAAGATGG + Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052989171 9:34508643-34508665 CTTGGCTTGAGGAAGGAAGGTGG - Intronic
1053160373 9:35809918-35809940 TGAGGGGTGAGGAGGGAAGTGGG - Intronic
1053423843 9:37998203-37998225 CTTGGAGGGAGGAGGGAGGAGGG + Intronic
1053481395 9:38418989-38419011 CTTGGGGTGAAGGGAGAAAATGG + Intronic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1054875277 9:70089624-70089646 GTTGTGGTGAGGAGAGAAGCTGG + Intronic
1054877060 9:70107911-70107933 CTCAGTGTGAGGAGTGAAGAGGG + Intronic
1055067306 9:72131728-72131750 CTAGCAGTGAGGAGGGAAGATGG - Intronic
1055381337 9:75710190-75710212 CTTGAGTTGAGGAGTGGAGATGG - Intergenic
1055494289 9:76839342-76839364 CCTGGAGTGAGGAAGCAAGAGGG + Intronic
1055860890 9:80747671-80747693 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
1056081811 9:83102787-83102809 CCTGGGGTGATGAGGACAGACGG + Intergenic
1056138887 9:83655356-83655378 GGTTGGGTGAGGAGGGAATAGGG + Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056262512 9:84862903-84862925 CCTGGGGTGGGGAGGGCAGGTGG + Intronic
1056306596 9:85296680-85296702 CTTGTGGTGGGGAGGAAGGAAGG - Intergenic
1057083083 9:92187409-92187431 CTTGGGGAGAGCAGGAAAGGTGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057674407 9:97127339-97127361 CCTGGGGGCAGGAGGGAAGTGGG + Intergenic
1057937718 9:99254718-99254740 CATGGGGTGGGGAGGGATGGAGG - Intergenic
1058349190 9:104000572-104000594 GTTCAGGGGAGGAGGGAAGAGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058453826 9:105120930-105120952 TCTGGAGTGAGTAGGGAAGAGGG + Intergenic
1059102996 9:111487507-111487529 ATTGGGGTGAGGAGGAAAACAGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059613535 9:115924582-115924604 ATTGGGGAAAGGAGGAAAGAAGG + Intergenic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060207142 9:121688828-121688850 CGCAGGGTGAGCAGGGAAGAGGG + Intronic
1060740738 9:126096079-126096101 CGTGGGGTGGGTAGGGAAGTGGG + Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061193494 9:129095278-129095300 TTTGGGGGGACCAGGGAAGAGGG + Exonic
1061256463 9:129456434-129456456 GTGGAGGTGAGGCGGGAAGAAGG + Intergenic
1061279127 9:129586951-129586973 AGTGTGGGGAGGAGGGAAGAGGG - Intergenic
1061430661 9:130528313-130528335 CCTGAGATGAGGAGGGAAGGTGG + Intergenic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061781678 9:132999893-132999915 CTTGGGGTTAGGGAGGAAAAGGG - Intergenic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1061924012 9:133797206-133797228 CCTGGGGTGAGGATGGATGAGGG + Intronic
1061924053 9:133797339-133797361 CCTGGGGTGAGGATGGATGAGGG + Intronic
1061994522 9:134176961-134176983 CATGGGGGGAGGAGGAGAGACGG - Intergenic
1061994537 9:134177007-134177029 CATGGGGGGAGGAGGAGAGACGG - Intergenic
1062204069 9:135326102-135326124 CTTGGGGGGTGGCGGGAAGTGGG + Intergenic
1062403031 9:136380707-136380729 CTTGGGGTGAGAAGTGAGGATGG - Intronic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203415511 Un_KI270582v1:2730-2752 GTTGGGGGGAGGAGCCAAGAAGG - Intergenic
1203718932 Un_KI270742v1:185455-185477 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1203653166 Un_KI270751v1:149130-149152 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1186786430 X:12960108-12960130 CTTGGGGTGGGGCGGGGAGTGGG + Intergenic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187623862 X:21089173-21089195 TTTGGGATGAGGAGCCAAGATGG + Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188525478 X:31083445-31083467 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
1188811220 X:34656609-34656631 CCAGGGATGGGGAGGGAAGAGGG + Intronic
1189002162 X:36958312-36958334 CCAGGGATGGGGAGGGAAGAGGG - Intergenic
1189008387 X:37018966-37018988 CCTGGGGTGAGGAGAGGACAAGG - Intergenic
1189040340 X:37536044-37536066 CCTGGGGTGAGGAGAGGACAAGG + Intronic
1189324697 X:40105439-40105461 CCTGGGGCGAGGAGGGATCAGGG - Intronic
1189745921 X:44168657-44168679 TTTGGGGAGAGGAGGCAAAATGG + Intronic
1190179749 X:48182180-48182202 CATGGGGAGAGGAGAGGAGAGGG - Intergenic
1190192761 X:48291393-48291415 CATGGGGAGAGGAGAGGAGAGGG - Intergenic
1190221814 X:48516754-48516776 GGTAGGGTGAGGAGGGGAGATGG + Intronic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190408311 X:50109925-50109947 CATGGGGTGGGGAGGGGGGAGGG - Intergenic
1190932675 X:54962601-54962623 ATTGGGGAGAGGAAGGAAGAGGG + Intronic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1192169692 X:68846659-68846681 CCTGGGTGGGGGAGGGAAGAAGG - Intergenic
1192172861 X:68867658-68867680 GTGGGGGCGAGGAGGCAAGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192358092 X:70422298-70422320 TCTGGGGTGATGAGGGAAGGTGG + Intergenic
1192943808 X:75942561-75942583 CTTGGGGGAATGGGGGAAGATGG - Intergenic
1193092512 X:77510035-77510057 CTTGAGGTGAGGAGAGGAGAGGG + Intronic
1193303931 X:79926796-79926818 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193487371 X:82103130-82103152 CTTGAGGAGAGGAGAGAAGTCGG - Intergenic
1193487659 X:82107094-82107116 CTTGAGGAGAGGAGAGAAGTAGG - Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1194544434 X:95215055-95215077 TGTGGTGTGGGGAGGGAAGAGGG + Intergenic
1194908992 X:99615545-99615567 CTTGGGGTGAAGAGAGAGTATGG + Intergenic
1195171418 X:102272407-102272429 CTTGGGGTGATTAGGGCAGGTGG - Intergenic
1195187442 X:102414692-102414714 CTTGGGGTGATTAGGGCAGGTGG + Intronic
1195308175 X:103606320-103606342 CTTGGTGGGAGGGAGGAAGAGGG + Intergenic
1195421305 X:104678104-104678126 TTTGGGGGGAGGAGCCAAGATGG - Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1196092253 X:111757714-111757736 AGTGAGGTGAGGAGAGAAGATGG + Exonic
1196270113 X:113700044-113700066 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1196733247 X:118962582-118962604 CTTGTGGTAAGGAGGAAGGAAGG + Intergenic
1197226554 X:123961117-123961139 CTTGGGGGGAGAAGGGAGAAAGG - Intronic
1197321019 X:125031104-125031126 CTTAGAGTGGGGAGGGAGGAGGG - Intergenic
1198018004 X:132631319-132631341 CTGGGAGTGAGGATGGAAAAGGG + Intronic
1198242004 X:134796513-134796535 GATGGAGGGAGGAGGGAAGAGGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198451191 X:136768047-136768069 CTGGGGGTGAGGGAGGAAGCAGG - Intronic
1198459208 X:136847296-136847318 CCAGGGGTGAGGGAGGAAGAAGG - Intergenic
1198893676 X:141427228-141427250 ATTGGGGGGAGGAGCCAAGATGG - Intergenic
1199411167 X:147525195-147525217 CTTTGGTGGAGGTGGGAAGAGGG - Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200146677 X:153929958-153929980 CGTGGGGTGAGGAGGGGATGGGG + Exonic
1200270787 X:154680716-154680738 CTTGGGAGGAGAAGGAAAGATGG - Intronic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200353353 X:155522030-155522052 GTTGGGGGGAGGAGCCAAGATGG - Intronic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201173088 Y:11290297-11290319 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1201981087 Y:19911071-19911093 CTTGGGATGAGGAGAAAACAAGG + Intergenic
1202366278 Y:24168200-24168222 CGTGGGGTGGGGAGGGAGGCGGG - Intergenic
1202504503 Y:25501923-25501945 CGTGGGGTGGGGAGGGAGGCGGG + Intergenic