ID: 1136370091

View in Genome Browser
Species Human (GRCh38)
Location 16:29830819-29830841
Sequence CCTCTTTGGTAGTGGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136370086_1136370091 18 Left 1136370086 16:29830778-29830800 CCTCGCTTGGGCGATAGAGAGGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1136370091 16:29830819-29830841 CCTCTTTGGTAGTGGAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1136370084_1136370091 19 Left 1136370084 16:29830777-29830799 CCCTCGCTTGGGCGATAGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1136370091 16:29830819-29830841 CCTCTTTGGTAGTGGAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136370091 Original CRISPR CCTCTTTGGTAGTGGAGACC TGG Intronic
900272471 1:1798581-1798603 CCTCTCGGGCAGTGGAGACACGG - Intronic
900402890 1:2479864-2479886 CCTCGCTGCTGGTGGAGACCAGG - Exonic
900647529 1:3715671-3715693 CCTCTGTTGGTGTGGAGACCTGG - Intronic
901493571 1:9608884-9608906 CCACTCTGGTAATGGAGACTGGG - Intronic
906079897 1:43079056-43079078 TCTCTTTGGTAAGGGAGAACAGG + Intergenic
906460954 1:46034859-46034881 CCTCTTGAGTAGTGGTGAACGGG - Exonic
910098656 1:83552946-83552968 GCACTTTGGTAGTGGAGCCAGGG + Intergenic
910175884 1:84429821-84429843 CCTCTTTGGTATTTGAGACTTGG + Intergenic
910559703 1:88577182-88577204 CCTCTATTAGAGTGGAGACCCGG + Intergenic
912570725 1:110619134-110619156 ATTCTTTGGGTGTGGAGACCAGG - Intronic
915838525 1:159197285-159197307 TTTCTTTGGTAGTGGTGGCCTGG + Intronic
917286202 1:173423934-173423956 CCTCCTTGGAAGCAGAGACCAGG - Intergenic
917705783 1:177633295-177633317 CTGCTTTGTTTGTGGAGACCTGG + Intergenic
919754086 1:201055823-201055845 TGTCTTTGGTGGTGGAGGCCAGG - Intronic
920531572 1:206706359-206706381 CCTCTTTGTTAGTGGAGAAAGGG + Intronic
920721869 1:208395122-208395144 CCTCTTTTTTAGTGGACACCTGG - Intergenic
922561269 1:226571438-226571460 CCTATTTGGTGATGAAGACCAGG + Intronic
1063372229 10:5529386-5529408 GCTCTTTGGAAGTGCTGACCAGG - Intergenic
1064892331 10:20191527-20191549 CCTCTGTGTTAGTGGAGTGCAGG - Intronic
1067854482 10:49780404-49780426 CCTCTAGGGTGGTGGAGACAAGG - Intergenic
1068690739 10:59911154-59911176 CCTCTTTGCTACTGGAGCCTGGG - Intergenic
1069605629 10:69737164-69737186 TCTCTTTGGCACTGGATACCTGG - Intergenic
1071563904 10:86661935-86661957 CATCTCTGGTAATGGAGACCAGG - Intronic
1074617502 10:115084126-115084148 CCTGTTTGGTTGTTGAGACTGGG + Intergenic
1075827287 10:125370243-125370265 CCTCTTTGGGTGTGGGGCCCTGG + Intergenic
1076047779 10:127308297-127308319 CCTCGTTGGTGGAGGTGACCTGG + Intronic
1076615164 10:131750110-131750132 CCTCCTTGAAAGTGGACACCCGG + Intergenic
1081060084 11:38463375-38463397 CCTTTTGAGTACTGGAGACCTGG - Intergenic
1092521324 12:9276367-9276389 GCTCTTTGGTGATGGAGACGAGG + Intergenic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1097284118 12:57864702-57864724 CCTCGTTTGTGGTGGAGGCCAGG + Intergenic
1097501168 12:60404535-60404557 TCTCTTTGGTAGTGGATAATAGG - Intergenic
1097516097 12:60608255-60608277 CCTCTTTGCCATTGCAGACCTGG - Intergenic
1098403907 12:70103742-70103764 CCTTTTTCATAGAGGAGACCTGG + Intergenic
1098468092 12:70811738-70811760 CCTCATTGGTAGTGTGGACATGG - Intronic
1102549264 12:113679333-113679355 CAGCTTTGGTATAGGAGACCTGG - Intergenic
1102783353 12:115584468-115584490 CCACTTTGATAATGGAAACCAGG - Intergenic
1104751606 12:131243758-131243780 CCTGGGTGGTACTGGAGACCAGG - Intergenic
1104780286 12:131415317-131415339 CCTGGGTGGTACTGGAGACCAGG + Intergenic
1105703051 13:22948217-22948239 GCTCTTTGGTAATAGATACCTGG - Intergenic
1110931542 13:81224446-81224468 TCTGTTTGGAAATGGAGACCTGG + Intergenic
1113047087 13:106167878-106167900 CCTCTTTGGTCCTTGAGTCCTGG + Intergenic
1115692485 14:35859114-35859136 CCTTTTTTGTAGTAGAGACTGGG + Intronic
1115795738 14:36933374-36933396 TCTGTCTGGTACTGGAGACCTGG - Intronic
1118853068 14:69599715-69599737 CTTCTCTGGTAGGGGAGACGGGG + Intergenic
1121854195 14:97251606-97251628 ATTTTTTGATAGTGGAGACCTGG - Intergenic
1121954664 14:98203056-98203078 CCACCTTGGAAGTGGAGACCAGG - Intergenic
1122710423 14:103652818-103652840 CCTCTTTGTTAGTGGAGTGGAGG + Intronic
1122844641 14:104486142-104486164 GCTCTTTGGTAATAGATACCTGG - Intronic
1123683297 15:22779064-22779086 CTTTTGTGGTAGTGGGGACCTGG - Intronic
1124335497 15:28853457-28853479 CTTTTGTGGTAGTGGGGACCTGG - Intergenic
1124883197 15:33660772-33660794 CCTCTTAGCAAGGGGAGACCAGG - Intronic
1132026716 15:98410029-98410051 TCTCTTTGATAGTGGAGCCCAGG - Intergenic
1132637555 16:959783-959805 CCTCTCTGCTAGTGGGAACCTGG - Intronic
1132682592 16:1149275-1149297 CCTCCTTGGTGGCGGTGACCTGG + Intergenic
1136370091 16:29830819-29830841 CCTCTTTGGTAGTGGAGACCTGG + Intronic
1137388971 16:48065823-48065845 CCTCTGTGGTAGTGAAGATTTGG - Intergenic
1140283192 16:73574487-73574509 ATTCTTTGGGAGTAGAGACCAGG + Intergenic
1140899623 16:79355770-79355792 CCACTTTGCTAGTGGAGGCCGGG - Intergenic
1143437603 17:6940662-6940684 CCTCAGTGGTAGTGTAGATCAGG + Intronic
1143974438 17:10819785-10819807 TCTCTTTGGAATAGGAGACCTGG + Intergenic
1151942735 17:77302821-77302843 CCTTTCCAGTAGTGGAGACCAGG - Intronic
1156303096 18:35852716-35852738 CCTGGTTGCTAATGGAGACCCGG + Intergenic
1164978948 19:32598165-32598187 CCTCTTGGGGAGTGGAGAGGGGG + Exonic
1165731928 19:38151466-38151488 CCTGCTTGGAAGTGGAGAACTGG + Intronic
1166071077 19:40388389-40388411 CCTCTTGGGTACTGAAGCCCTGG - Intronic
1166744826 19:45136646-45136668 CCTCCTTGGGGGTGGAGGCCTGG - Intronic
925218877 2:2121828-2121850 CCACTTTGCTACTGGAGCCCAGG + Intronic
925239919 2:2316064-2316086 CCTCCTTGGTAATAGTGACCTGG + Intronic
927320212 2:21735034-21735056 CCTGTTTGGGAGTGGAGTGCGGG + Intergenic
929958426 2:46478269-46478291 CATCTTTGGTAGTTGAAAGCAGG - Intronic
931384445 2:61785177-61785199 CCTCTTTGCTAGTGCAGAAAAGG - Intergenic
932598441 2:73108484-73108506 CCATTTTGGTTGGGGAGACCTGG - Intronic
932899078 2:75677464-75677486 CATTTTTGGTTGTGAAGACCGGG + Intronic
934752194 2:96800375-96800397 CCACTTTGGTGCTGGAGAACAGG + Intronic
936153275 2:110033086-110033108 CCTCCTGGGCAGTGGAAACCTGG + Intergenic
936191406 2:110338329-110338351 CCTCCTGGGCAGTGGAAACCTGG - Intergenic
937520495 2:122707747-122707769 CCTGGTTGCTAATGGAGACCTGG + Intergenic
945781272 2:214175523-214175545 CCTCTTGGCTAGTGGAGATCGGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
948315681 2:237026809-237026831 CCTCATTGGGAATGGAGACCAGG + Intergenic
948675933 2:239596692-239596714 CCTCTTAGAAACTGGAGACCAGG + Intergenic
1169093438 20:2875137-2875159 TCTCTTGGGAAGTGGATACCGGG - Intronic
1170714497 20:18820130-18820152 CCTCTTTGGTGGTGCTGTCCTGG - Intronic
1172234512 20:33361501-33361523 TCTATTTGGTAGTGGATTCCAGG - Intronic
1173169571 20:40713075-40713097 CCTCATTGCTAGAGGAGACAAGG + Intergenic
1175900238 20:62357164-62357186 CATCTTGGGTTGGGGAGACCAGG + Intronic
1176311304 21:5151885-5151907 CCTGTTTGGTGGCAGAGACCTGG + Intronic
1178636864 21:34311478-34311500 CCTCTTTGGGAGTGGTGGCATGG + Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1179845746 21:44110150-44110172 CCTGTTTGGTGGCAGAGACCTGG - Intronic
1181287899 22:21767637-21767659 CCCCTTTGGTATGGAAGACCAGG + Intronic
1182552141 22:31106287-31106309 CCTCTTAAGCAGTAGAGACCTGG + Intronic
1183013841 22:34969892-34969914 CTTATTTGCTAGAGGAGACCCGG - Intergenic
1183782859 22:40009732-40009754 GCTCTGTGGTTGTGGACACCTGG + Intronic
950568909 3:13788017-13788039 CCTCAGAGGTAATGGAGACCGGG + Intergenic
951486714 3:23220898-23220920 CCTCGGTGCTAGTGGAGAACTGG + Intronic
954011278 3:47641361-47641383 CCTCCTGAGTAGTTGAGACCAGG - Intronic
956719763 3:72107481-72107503 CCTCTTTTGTAGTTGTGACAGGG - Intergenic
959154785 3:102653559-102653581 CCATTTTGGAAGTGAAGACCTGG + Intergenic
960588057 3:119339128-119339150 CAGCTTTGGTAGGGGAGAGCTGG + Intronic
961549470 3:127660799-127660821 CCTCTTGGCTGGTGGAGTCCTGG - Exonic
964766957 3:160188699-160188721 CCCCTTTGGGTGTGGTGACCAGG - Intergenic
965592581 3:170376406-170376428 CCTCTTTGGTCATGTAGAGCTGG + Intronic
966940208 3:184741300-184741322 CCTCTTTGGTGGAGGAATCCCGG + Intergenic
969475615 4:7421022-7421044 CCTCCTTGGAGATGGAGACCCGG + Intronic
970175770 4:13338071-13338093 CCTCCTTGGTAACTGAGACCAGG - Intergenic
970787738 4:19820039-19820061 CCTCCTTGGTAGTGTAGAAAAGG + Intergenic
974807091 4:66894583-66894605 CCTCTTTGGGAGGGGAGGCCTGG - Intergenic
976693446 4:87893436-87893458 CCTCCTTGGTAACTGAGACCAGG - Intergenic
982362645 4:154537440-154537462 CATCTTTGGGACTGGAGAACTGG - Exonic
982759436 4:159263512-159263534 CCTCTGTGGTAGTGGGGAGAGGG + Intronic
983668919 4:170213789-170213811 CTTCTTAGGTACTGGAGAGCTGG + Intergenic
984295470 4:177848789-177848811 GCTCCTTGGTAGCAGAGACCTGG + Intronic
984580256 4:181502639-181502661 CCTGCTTGGTGGTGGAGACTGGG + Intergenic
986393905 5:7309570-7309592 CTTTTGTGGTAGTGGGGACCTGG - Intergenic
988262919 5:28912077-28912099 TATCTTTGGTAGTGGGGAACAGG + Intergenic
990662006 5:58026513-58026535 GCTCTTTGGGAGTAGAGACTTGG - Intergenic
990788464 5:59449812-59449834 CCTGTTTTGTAGTGGAGATTGGG - Intronic
991348582 5:65696216-65696238 CCTCTTAGGTGATGGAGAACTGG - Intronic
994335601 5:98561878-98561900 CCATCTTGGAAGTGGAGACCAGG + Intergenic
997962102 5:138330327-138330349 TCTCTTTGCTAGTTGAGACATGG + Intronic
1000353758 5:160373495-160373517 CCACTTTGCTGGTGGTGACCTGG + Intergenic
1001421298 5:171589320-171589342 CCTCTTTGTTAGTGGAGAGGGGG + Intergenic
1007780637 6:44252132-44252154 CCTCCTTGGTAACTGAGACCAGG - Exonic
1008046263 6:46854416-46854438 CCTCTTGGGTTGTGGTGACTTGG + Intronic
1010875717 6:81102969-81102991 CATTTTTTGTAGTGTAGACCTGG + Intergenic
1012083245 6:94787236-94787258 CCTCTTTTATAGTGGAAAACAGG - Intergenic
1015939626 6:138434734-138434756 CCTCTGTGTCAGTGGACACCTGG + Intronic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1022379087 7:29843122-29843144 CTTCTTTGGTGGTGAACACCAGG + Intronic
1023801139 7:43835606-43835628 CCTCTTTTGTTTTGGAGACAGGG - Intergenic
1024978229 7:55133395-55133417 CCTCTTTGTTACTGGAGAGCTGG - Intronic
1026871811 7:73857325-73857347 CCTCTGTGGCAGTGGAGTTCTGG + Intergenic
1029204230 7:98859257-98859279 CCTTTTTGGTGGAGGAGAACAGG - Intronic
1030968483 7:116023952-116023974 TCCCTTTTTTAGTGGAGACCTGG + Intronic
1031907458 7:127476294-127476316 CTGCTTTTGCAGTGGAGACCAGG - Intergenic
1033552547 7:142460632-142460654 CCTCTTTGTGAGTGGGGTCCTGG - Intergenic
1033557064 7:142497589-142497611 CCTCTTTGTGAGTGGGGTCCTGG - Intergenic
1034978742 7:155462374-155462396 CTTCTTTGGTTTTCGAGACCTGG - Exonic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1043453441 8:80391572-80391594 CCTCTCTAGTAGGGGAGACAGGG + Intergenic
1048234649 8:132677781-132677803 CCATCTTGGAAGTGGAGACCAGG - Intergenic
1053278042 9:36798080-36798102 CCTCTTTGGGAGTAGAAAGCGGG - Intergenic
1054803307 9:69374518-69374540 TCTCTTTGCTGGTGGAGACGTGG - Intronic
1055583576 9:77732894-77732916 TCTCTGTGGAAGTGGAGCCCAGG - Intronic
1057285279 9:93748744-93748766 CCTCTTTTGTCGTTGTGACCTGG - Intergenic
1058431923 9:104927673-104927695 CATCTCTGGGCGTGGAGACCCGG - Intronic
1061288176 9:129635969-129635991 CCTGCTTGGCAGTGGAGACCTGG + Exonic
1062447913 9:136603472-136603494 CCTCATTGGTTGTGGAGCCTGGG - Intergenic
1185491565 X:521272-521294 CCTCTTTGGCAGTGGAGCTCTGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1202071503 Y:20996495-20996517 ACTCTCTGCTAGTGGAGACGAGG + Intergenic