ID: 1136373544

View in Genome Browser
Species Human (GRCh38)
Location 16:29850885-29850907
Sequence TGAGGTCGGAGCTGGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373544_1136373547 -9 Left 1136373544 16:29850885-29850907 CCATTACTCCAGCTCCGACCTCA No data
Right 1136373547 16:29850899-29850921 CCGACCTCACCCAAGAGCTCTGG No data
1136373544_1136373553 28 Left 1136373544 16:29850885-29850907 CCATTACTCCAGCTCCGACCTCA No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373544 Original CRISPR TGAGGTCGGAGCTGGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr