ID: 1136373546

View in Genome Browser
Species Human (GRCh38)
Location 16:29850899-29850921
Sequence CCAGAGCTCTTGGGTGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373546_1136373553 14 Left 1136373546 16:29850899-29850921 CCGACCTCACCCAAGAGCTCTGG No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373546_1136373555 25 Left 1136373546 16:29850899-29850921 CCGACCTCACCCAAGAGCTCTGG No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373546 Original CRISPR CCAGAGCTCTTGGGTGAGGT CGG (reversed) Intergenic
No off target data available for this crispr