ID: 1136373548

View in Genome Browser
Species Human (GRCh38)
Location 16:29850903-29850925
Sequence GAGTCCAGAGCTCTTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373548_1136373557 29 Left 1136373548 16:29850903-29850925 CCTCACCCAAGAGCTCTGGACTC No data
Right 1136373557 16:29850955-29850977 GTGGACCTCAATTGGTGATCAGG No data
1136373548_1136373553 10 Left 1136373548 16:29850903-29850925 CCTCACCCAAGAGCTCTGGACTC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373548_1136373555 21 Left 1136373548 16:29850903-29850925 CCTCACCCAAGAGCTCTGGACTC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373548 Original CRISPR GAGTCCAGAGCTCTTGGGTG AGG (reversed) Intergenic
No off target data available for this crispr