ID: 1136373549

View in Genome Browser
Species Human (GRCh38)
Location 16:29850908-29850930
Sequence GAAATGAGTCCAGAGCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373549_1136373555 16 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373549_1136373557 24 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373557 16:29850955-29850977 GTGGACCTCAATTGGTGATCAGG No data
1136373549_1136373559 30 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373549_1136373553 5 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373549 Original CRISPR GAAATGAGTCCAGAGCTCTT GGG (reversed) Intergenic