ID: 1136373550

View in Genome Browser
Species Human (GRCh38)
Location 16:29850909-29850931
Sequence GGAAATGAGTCCAGAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373550_1136373559 29 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373550_1136373555 15 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373550_1136373553 4 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373550_1136373557 23 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373557 16:29850955-29850977 GTGGACCTCAATTGGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373550 Original CRISPR GGAAATGAGTCCAGAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr