ID: 1136373553

View in Genome Browser
Species Human (GRCh38)
Location 16:29850936-29850958
Sequence CATGCCTTGATGTCTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373548_1136373553 10 Left 1136373548 16:29850903-29850925 CCTCACCCAAGAGCTCTGGACTC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373546_1136373553 14 Left 1136373546 16:29850899-29850921 CCGACCTCACCCAAGAGCTCTGG No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373545_1136373553 20 Left 1136373545 16:29850893-29850915 CCAGCTCCGACCTCACCCAAGAG No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373549_1136373553 5 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373544_1136373553 28 Left 1136373544 16:29850885-29850907 CCATTACTCCAGCTCCGACCTCA No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data
1136373550_1136373553 4 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373553 16:29850936-29850958 CATGCCTTGATGTCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373553 Original CRISPR CATGCCTTGATGTCTCCACG TGG Intergenic
No off target data available for this crispr