ID: 1136373555

View in Genome Browser
Species Human (GRCh38)
Location 16:29850947-29850969
Sequence GTCTCCACGTGGACCTCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373551_1136373555 -6 Left 1136373551 16:29850930-29850952 CCAATCCATGCCTTGATGTCTCC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373548_1136373555 21 Left 1136373548 16:29850903-29850925 CCTCACCCAAGAGCTCTGGACTC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373550_1136373555 15 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373549_1136373555 16 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data
1136373546_1136373555 25 Left 1136373546 16:29850899-29850921 CCGACCTCACCCAAGAGCTCTGG No data
Right 1136373555 16:29850947-29850969 GTCTCCACGTGGACCTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373555 Original CRISPR GTCTCCACGTGGACCTCAAT TGG Intergenic
No off target data available for this crispr