ID: 1136373559

View in Genome Browser
Species Human (GRCh38)
Location 16:29850961-29850983
Sequence CTCAATTGGTGATCAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136373551_1136373559 8 Left 1136373551 16:29850930-29850952 CCAATCCATGCCTTGATGTCTCC No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373554_1136373559 -2 Left 1136373554 16:29850940-29850962 CCTTGATGTCTCCACGTGGACCT No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373549_1136373559 30 Left 1136373549 16:29850908-29850930 CCCAAGAGCTCTGGACTCATTTC No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373552_1136373559 3 Left 1136373552 16:29850935-29850957 CCATGCCTTGATGTCTCCACGTG No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data
1136373550_1136373559 29 Left 1136373550 16:29850909-29850931 CCAAGAGCTCTGGACTCATTTCC No data
Right 1136373559 16:29850961-29850983 CTCAATTGGTGATCAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136373559 Original CRISPR CTCAATTGGTGATCAGGCTT TGG Intergenic
No off target data available for this crispr