ID: 1136374318

View in Genome Browser
Species Human (GRCh38)
Location 16:29856343-29856365
Sequence TTCCCCACCTTGACTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136374313_1136374318 12 Left 1136374313 16:29856308-29856330 CCAGGCCCTGTGACCTAGATCTG No data
Right 1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG No data
1136374314_1136374318 7 Left 1136374314 16:29856313-29856335 CCCTGTGACCTAGATCTGTTTCT No data
Right 1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG No data
1136374315_1136374318 6 Left 1136374315 16:29856314-29856336 CCTGTGACCTAGATCTGTTTCTT No data
Right 1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG No data
1136374311_1136374318 30 Left 1136374311 16:29856290-29856312 CCTGGAGCACTTGGTGCTCCAGG No data
Right 1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG No data
1136374316_1136374318 -1 Left 1136374316 16:29856321-29856343 CCTAGATCTGTTTCTTTTTTTTT 0: 2
1: 3
2: 179
3: 2043
4: 14171
Right 1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136374318 Original CRISPR TTCCCCACCTTGACTGGAGC AGG Intergenic
No off target data available for this crispr